Description :
Non Conding Region
Location :
Scaffold_1:35933- 36786
Sequence
853 bases(100 bases per row)
CTCTCGCTCGCTACGAAGACTGACTCGAAGACAACTATTTTATTTTCTATGGACATCGATCGGCCCAACTAAGCCATGTGCGCCTGTAGCTGCTTAAGCA
GAACTCGCGGGAAGATACCAGCTTGCACTTATGAAAACGGGAGCAGCCTCCCTTATAGCCAGCCACCAGACAACGCTCGTATGTATAAAGAACTAAAAAA
AATAATTGGAAAAGCATGAGTCATGGTGTCTTCACGTTGTGGATCACAGACCATTTGCACAAATGTGACGCGAAGCTAGAGCTCATGCTGACAAACAGAT
GAAGTGCACCTTTAGCGTTAGCGTGGCATTCATCATGCAACACGAAAAGCTATGAACGGCATCCAACATTGCCTCTATCTATTTGCGGTGAGAGTTTTGT
ACTAGTAATGGTTATCCTGTAGAGATTTGTGGCATCTCATCAagtatgtacatgtacgtgttCAATGATTCACTGGTGAACTAAGATGGCCGTGAATAAA
TTCCTACGCAAGAGTGTTCATTTCGCTGCTCGGATGGAGCGCTGCATCTGTAATGCCCCACCTCAACACCGAAGCGAGTCTCGTCTTTTCGGTGGTCGTC
ATGAAATTGTTTAACGATAACCACCAAGGGAACACGTTAGCAAAGGAAGTTGCCTTTCAGCAGGCTTAGCGGCAAATTACAAGAAAAATTTGGATTGCCT
TTTTTCTACAAGCTCGAAGTGCGTCAAAACTATCATGACAATAAATATTCAACGCGCCTCCCTACTCCTCCGATTTGTccccgctggagctgcgaAAGTC
TCCTAAGATTGATTCTCTATGCGCACGCTCACCAAACGAGCGGGGACCACCAT