Description :
Non Conding Region
Location :
scaffold_1:35710- 36413
Sequence
703 bases(100 bases per row)
TCATTGAGCTGATCCAGCGTCTTGGTGCCGTCATTCTCAAAGAACGTCACGTCCTTGTGGCCGCCATTGTGCTCCTGGTTAATAAACGTGTCAAACACGA
CGCCAATGCCCTTGAACTCCCCAATGAAGCCGTGATTGTCGCCCTGTACAAACTGACTAGTAGTGAGCCAGAGCGCCAGTCCATCTCCAAACCACGACTT
GGCCTGGCCGCTGATGCGGAACGTGAACACCGCAGCGAAATCCTTGGCTGCCAGTTTCTCCTTGCCCCAAATGTGGCCACGTTTGCTCTGACGGTCGGGC
GTTAGACGCGCAAAGTGGCGGTTCACAGCCGTGTCGCCACCGTAGACGAAATTGTCGCTAATCTGACGCAACCCCTCGCCATTAATGTTGTCAAAAGGTT
TCTCGAATGAGACGTGGTCCAGGCGCTTGGCGCTTGTAGGAGAGGACTGTAACAAGGCGAGCAATGCAGCCACGCACAGCAGCAGCAGACGAGAGACGCT
CATGGTCGAGGCGGTCGAGACGCGGAATCAAAGACGCTGGTCCGATTTGCTACGTGGCAATAAGCCGAACTGAAGTACCGAGGATGTAAACTTAAGTCCG
AATTCGTACTTAAATTGACAGGTAACGTAACCCTGATTTAGGTGATTAATCGGGGTTACATTTTGGGTTACGCAAGTTGGCGCGAACCACTCCATCGCGA
TCA