Description :
Non Conding Region
Location :
Scaffold_1:35693- 35912
Sequence
219 bases(100 bases per row)
CTGGAGGCTCTCCGCTGCAGCACAAGCGGCTATGAAGCAGGCAGGGTACCGACACAGCAGCCCTCGAGATGCTCCTGCGCTTCCTGCCCGCCTACACTAC
TTATATAAATATTTTGCGGCGCACTGATCAGCTGATCAATTCTTCACGCGCCGATTGAGTTCAAGACAATGACCGAGACCAAGATTTGAGCGTACGATAC
ATGGGCCACCACACCAAAA