Description :
Non Conding Region
Location :
Scaffold_1:35652- 38267
Sequence
2615 bases(100 bases per row)
CGCAGTGCGATGCTGACGTTTTTTCCGGATTGGTTTCTTCAATGAAGCTTCTCACGTCTCCAACACATTCGAAGTAGTTTTGCGTTTCTTCATCTTCTTG
TTGCTTCAGCTCGGCGTCCAGTGCCGCTGACAAAGCACTCGCTGAACGACTCGTCATCGTGTTGAAAGTGGCGCTGAAGCTGCTTTACTGATGTATCCGC
TTCTCTGCAAGCATGCAAAATGGCGAATGGCCAGGTAACTCTGCCAGAAATAATCGAAACTTTTACTGCAGTCTTGAGCAGCCGCCAGTAAAACCATTGT
TGGAAAAAATTTGCCTAGAATCAGTTCTGCGTGGTATGAGCAACAAATTATTAAATATCGTCTCTAAAAAATCGCCATCTCAAATCAATTTTCATGGTGT
GTTTTGGCAGTATAATTCAATAAATAAAAATACGACCCGTGTGATGTCTCTGTTTGTAATAATTCGCTGAGGGCACCTCACCATATTAACGATCTGTTGG
TTCTTCACCGCCCACACATGTGCCGTCGAATCCCGATCGCATAAGCAATTTTACTTTGAAAAACAATCCATCGGCATCCGCAGCCTTGTACTTGTCGTCT
TCGCTGAGTAGTTTCGATTAAAATGATGTAAAGATCAGCACAATTATAATACTTGATGGAGAACACAACCTGACTTGGGTGGTGTTCTTCTCCAAACAAA
AGTCTCTATCTCTTGATAAACAAAGCCAATCGCACTCTGAAGAGCAACAATGATCCATACCGCAACATCGTTGACCTCCACAAGTGGTAGACTACTCAGT
GGGTACGATCTGCGTTCATAGGTCATCCAGGCTTAGCAAACAGATCATTCGCATTCACGTCAATCGTACGTCTTCACGATTTTAATCAAAACTGACTCAC
TGTCGGGATTGATAGTTCCACAATGATGTAGCTGGAAAGTATTTCCATGCCAAGTGAACGTACTTTAATGAGCCTCAGTTTGTTTGGAAGCGCACATAAA
TCAGGGCAACTTATAGAGCAAACAGGGGTATCCATTTCACTAAAATGCCTCAGTTTTAGATTAAATCAGCTGTTTAGGTCGTAACACTGCAACGTTTCCA
CGCTCCTCTATATTAAACTTACCCCCCCCCCCTAAAAAGTGGGCCTCGGTTTAACGACAATTGTCTCGCCCAGTCAGCTGCCAAGTTTATGTCATTAAAT
GCAGGTAAATTGCACACTTTTTGCCCCTAGAAGAGTGACCATTAAACTTTTCCCTACCCCTTCTCATAAAATAGCCGTAGTAAAGATAAATAAGAGAACT
AAAACCAAGTCACTTCATTATAGGGGGGGGGGGGGCAATAAGTTATAATTTTTTACAAATGTTGACATCAACATTTTCATTCCCCACCCATTTCTGCGTC
GGCTAGCTTGATTTCAATTCGATTAGTGACGTCACTCTGTGATGCCGAAAGGGCTGTATAATTGGCTTGGGATGTATTGGCACCGGGTCGGATTAAGACA
GGTGAGTCCGTTTCTCAAATGATAACTGTAAACACTGTAAAGCTCACTGCTAATCTTGGCTCGGAGAACGCTGAATCCATCGTTGTGTGCGAAATCGAAG
GTAATGGGAAGCCCATACGTCGTTCTACAATTCGTGTATGGTTGCCCAATTTTAACGTGGAGCTGGACTTGCAGTTTATCGGGCAATGGCAATCCCATTG
TCGCACTAGCACACGTAGCAAATTAGAAAAAGCATCCCGCTTCGAATGAGAATAGACCGTAGCTACTTACCGATTGGCTCGTAACGGAGCAGGACAATGT
GCAGATAAGCGCTTTCTCAGGTCTACAAGCTGGGAAAGTAGTACCCGCGCTCAGTCTTGTCGCTGTGGTATTGCGTTGTAGGCGCGGTTTTGCTATGTCA
CAGGGTAGGATTAACATATTTTTAACGTTGGGTTATGTTCTAGCTTTAGATTCACGAAAAAGATTTGTAGTTGTTTTAGAGGCGCTATTTATAAGTCAAA
CTTGCAAAAGCACAATATTAATAAAACAAATTACGCAAATGAAAATGAGAGCAATAACTATTTGGAAACGACGGGAAATATTTGATCTCGAAATGTTTCG
AAAAATAACTTCAGTATTCTTAGAAAACAAGCTAAAAATAGTACCGGGTGGAAATTGCCAGTAAAAATATGGAGTTAGCACTGCGAATTCTAACTATGAT
TGCGCTTCTATAGGCATATCGAAGCAGTATTGCATACATTCACCCAGTGCGAAGAAAAAAAGTTTTCTTTATCTGTGTAGCAGTGACATGAGTATTTTTC
CGCGTTCGGTAGGGTGAATGTTTAGTAACGGCGAAAAAGTTTGTAAATCCTCGCCATTATTAGTAGTACTGCGAATTCGGCTTTCCCCGCGTAGCGGAGC
GAGGCGGCAGGGGGTCGTGCGCTCCAGCAAAAAGATGCAATGAACCGTAGCGCTTCAGATGTCTATCAATATTTAGATTATGAACATTTACGCTGATGCA
TAAATTAGAATATAACTCCCCCGCCGAGCCGAGCGAGGCGGCGCATACTCGCGCTCGACTTCAACCTGCGTAAAGGTTCCCGCTTGCGGGTCTCCGCTCG
GCTTGTTTCCTCATA