Description :
Non Conding Region
Location :
Scaffold_1:3563- 3834
Sequence
271 bases(100 bases per row)
TGACTGTCATTGACGATGTCAAAGGTTGAGCGGACTACCAGGTAGTattggagatgaagctggagaaccaAAGTTTCGTGGTCATGGTACCGGTAGACAA
ACATACGAGCCAAGACAAAAAGGGTGAAGATCATGGTCTCCTAGCAAGTTTTCACACCGACAGCGACCATCGATTCAATCCTTTATTGGTAATCATTTTC
ACTCCGGCGCCCTCGTATCTACACGAATTGGTTGCTCCAGTCGAGTCTATGACAATAATTGACGCTTTATC