Description :
Non Conding Region
Location :
Scaffold_1:35468- 35552
Sequence
84 bases(100 bases per row)
GCATCAACATGATTTATGATTTCTTCTTCCTCCATCGTATCCGTCCATCCGTCTGCCAGTGCGACAAGATGGCAGTTGGCATCA