Description :
Non Conding Region
Location :
Scaffold_1:35415- 36942
Sequence
1527 bases(100 bases per row)
TGTGCCCTTCAAAGAAATATAGTAATGAGTTATGGTTCTGCTCTAGTACAAAAGGACCCATCACAATAGGAGCTAAGCTGGAATTTTTGCGAGCATAGGG
TATCCACCCTTTACTCCACATTAGGGCTAAATCGGCTGAATATATCAGGTGATAAAAAGCTAGGATGGGTTGATAACTATATTATTTGGGACCTGAACTT
AATTTGACATATTTGTTGCCTAATAAAGCAGAGAATTGAAAGCGGGAATCCGTTGCAGATGTCAGGAATTCCGAATGCTTGCTGCTTCCCTCTTTGAGGC
ATTGCCGGAATCCTTCCGATCATCAACGTGCGTCATTTAACTAAGTCAGAGACTATTAAGATTAGGGACATCGTAACCATCTACTGTACTCGGCTTTTCT
TAGGAATGGCAAGGTCGTGCCATCGATAATGGCGTCCAGCTCTCTCTACGCAGAATGAGAAATTTTAGAGCAACAGGAGCGGATTAGGGCAACGCTTAGT
GTTCTGTACCTATCATCCTATTTTTGCTCTATTCGGCCCAGGATTGCGTGGTTCACATCGACCATAAAGATACGAAGATCCATGCGAGCAGTCAATCTCA
TTTCTTTCACTCTGTAGCATCGACATTACCTTTGATCTTGTCGAAACTGGTTGGCTTTTTGTAAAATTCTCTGCCTAGAGTATCTATCATCACAAAGAAT
GCGCACTGTGTCCTTCAAGTTCAGGATGTTCTTGATTATCATACTGCTGATGCCACTACTGCCAGCGTTGACAGGTTTTAATCAGTTACGAGATTTCTCC
TCGAAAAAAATTCGTGATGCCTCACAGACAGAGCTTTATCCTTGTAAGCGATCTATAGTCACGATATTCGAATTACGCGTTCTCATTGCGATTCGTTTGT
CAATCAGTTGTTCCTGCCACCGTTTATGATAATGTTGATCAGGGGCGTGTTGCTACAATAACAATTCCGGCTCCTGGAACTATCGTTTTCCACGTCGACT
ATCAAATGGTTTACTACGCTGCTATATTTGCAAATAATACAAACTCACTCTCTATACTAGGACCCACGCTGCTACACAGAAAAAGTTGTTGACACAGGGC
TCAATTATCTACGTTCGTACTTTCACATGAAACTTAAGTGAGTGAAAGCATAATTGTGCCTACTTTCTAGTCGACGCGAAACCTATCGTCCGACTCTCGT
ACACTTCCAAGCAATTCGCAAACACCTCGTATAAGGCAGGACAAGCTGCATCCTTTAGAAGCGATTTCGAAAGCACCTCGAAGCCGTTAGAAAGCGATGG
AGTTTGTCAGCGTGAAGTCTCATCCTTGCATAAGATTCAAAACAACAGACGAGATTTTTGTGGAAGAATAAGTAGTGCAACCCAAAATATTGCCTTCGTC
ATACAAATACAGATCGTGGAATCGACTGTCAAAGAATTTGCAACATGGAGTTGGTATTTAGGCTTACCGTTTCGCTCAGGTTATGGAGGAGCTATATTTC
TTGACGGAGTTGTCGTGCGTGACTTTA