Description :
Non Conding Region
Location :
Scaffold_1:35390- 38539
Sequence
3149 bases(100 bases per row)
ACATTGACACGAGCGTGCCGAGCTCACAGTGCAGTTATCTATCGAAGGTATTTAGTAAACCATTTTAATGAAGCCGCGTCGAGTACGGTTGAAGAACTCG
GTCGGGCTCCTAAAGCTTTTATAAACAAGTTGTTCATTTACAACATGTGCAGGACTACAGTATCGGTGGAGCGACTCGCTATAACAGATACTATAATAGC
GACGAAGATACGCCAAGAGGTAGCTCGTCACTTGGCGACCAACATACAGCGTTGCGTGCGATAATAAATACCGCTATGGATAGTCCTGCCTGCCATAGAG
CGACAAGCTTGCGACCGCGACACCCGAAGTGGCCATCGTTGCTATGTGAGCCAAGGCCGTGCATGCTCCGACATCTTTTTTTTATCAGACCCGCAATGCG
TGACCCGCAATACCAGAAGCCACTGATCATGGGAACGCTACGAACCGTGATCCACAAAATAGCTTACCGATAGCTTACGAGGTTCGCCGCGGTTTGATTG
AAAGTGCCGTTGGTAGAAGTATAAACCCACGTTGTAAGCAGTGAGCGAGTAACAAGTCCAGTAGCAGAGTTCCTGGTAGTTTATACTCAGAAGGTCGAAT
TCACTGCGCGCATTGTCCAAGTTTCGGGCGCATTATGCATTGAGAAAAACGAATATATCGACTTCTCGAGTTTGTTGTACTTCGTCTGAGGTGCCTGTTA
CCGGTAAGCAGAGCTCCGCTTCAACTCCATCCGCATCTGTCATGTTCGCTGTAGAGATCTTGGCTTAATTAAGACCGCTCGTCGTTCTGGAGGTGCCTTC
GCGCGGTTACCGCATGCAACCCGAGCGAACCCTGCGCGGCCTGCTAGCCACTGGTCCCATGTGTGATATTCAATTCATGCGAAGCGGCAGATTGCATGCC
AGACGGATCGCCGGCAACCTCCAAGCCAGCCGGCGGCGTGAGCGCGGTCGGCTGATGGTTGCATTGAGCCCGCAGGGTATTGACCAACCGACACGGACAC
TAGGAAAGGAAGCATTCCGACGATCCGAGGACAGCTTCAACCCCTTGGCGCGTGTCGCTCCCCTCTCTAGGGAAAGCCACCTTGCGCATTGCCCGAGCGG
GCAGCAACACTGCCTTGCCAACACCCGCATGCATTGCAGAGCCCTAGCCGACGTTCGTTGGCGCCGCAGGTTTTGAATGAGCTGGCTCCATGGTGCGTCG
CTATGGTGCGGGGCAATGCGTGTCTGTGCTGTCTAGCAGCAGTTGTTGCTCTCGCTGAAAATGGGCACTTTCCGGGGCTCGAAAATGGGTCCTGCAAGTC
CATCTCAAAGACATGAAAAAATCGTGGCAGCTAGCCTGTTTACGCCAGCTGTGCTGTATGCCTGAAGACCACCTCGATATTTTTTGTAGGGAGGCATGGC
ATGCTGCGACGTTAGCACTGCCTACGAGCATGTTGCCAGCTACCTTGAGGCTTGGCTCTAGCATGCATCAAATGCTCCTTGAAGTCGTTGAAGTGTGTAC
GCTAATGCATCTTCTGGGCAAAGATACAGTCGGTATATCGTTGCCTCGAGTCTTGACGTTTGTCTTTCAAGCGGATCGATTGACGAGGCCACGGCTGGCA
AACTCAGCTGGGTCAATTCATATCGCATGACCAGGATTTCTCCAAAATTCATTCGTGCTCAATTGGCGCGGCGAAGGCGCTCTTCTATAATAGTGGCGAC
CAGCTAGCAGCGCTACATGGATGTATAGCATGCACTGTACGCTATTATATCGGCCCGCTGGCCTGCTGCAGCACTTCCGCCCTCGCAACGGGGGACTGGT
CGCCATGTCGAAGGGATTCTAAAACAATTGGGTCCAGGAACAGCATATACCCAAAATATGTAGTACAAAGTAATACTTTTGCCGTTAGTGACATTAATAA
ATAAAATTTCAATTTACTATTACTACCTCGAATACTATATTCTACCGTACTTATAATGATTTGCTGATTACTGTAGTAGTAGTAGTTTTATAGAGTGGTA
CTAATGGTAATATCGTCCGATATCACCAAACCACGTTTTCCGACGCGAATCAGAGCCTAAGAAAATTGCACAGCATGTCAACTCGGTTATTGGTACCTAG
GTCCTTGCTGCTATTTATCCACTTTTTGATTTACCAAGTCTACTTCATCCAATGATAGCGCTTCCCTACAATCAAAGCGTATGCAAAACACATAAGTAAT
CTGGTGCGCTGCTTTGTGGCTCTAAAAACAACTTTTTGTGTTGCTGACGTCTCACAAAAAGGTATCTGGCTACTGCAAAACTGGGCGCAATTGGCTAAAA
CAGGGGAGGGAGGTGCCGCGTCTGACAAATTAGAGCTCAGGTCGCGGAGCAGTGGTCAGGGAGGGTACTCGGGACTCAAAAAGTCTAGGTTCCACATCTT
ATACTGTCTTTTTAAGGAGGCATGACTTACGCTACACGTAACAGCCTGCTTCAGAACGGTATTCAATACCACCAAAGGGAGGTTATTTGAAAATTAACGA
GTTACAATCGAGCTCAAATTAAACACAAAGATTTACGAACAAGGAACAATAATTATATTACTCATTTGACTAGAGTTCAACCTGAATTTGAATTTGTTGG
GGTTTAGACTGCTATCTACTCCTGATGCTGCGCGCTGCTGCAGCCTCGTCTACGGAATACACGTTATGAGGACATGATCCACGGTAATAGCCCATCCGAT
TGTGCTTCATGAGTCGCCCTGAAATATCGCTACCTAAAGAATAATGGGATTTTCACGTTTCTCCTAGATTTCCTATTTCTAATATCCCATGAAAAAACGA
ATGATTTATAATACTCAAACAATGATCTCTAAAGGCGCTCGGCTCATTATTTTAGCCAGCTACAGGGTAAGTAAGTACTGTATATTGTGTCGGACGTTGT
CTCAACCTGCATTGGGGGAAGTTTGCCCCATCTTCAAATCCGCTTAAGGTGATCTGGACACTACTAATGTATCACTCGTAAATTAGTATTATACAAATTT
GCAGTTGTACTACTGTAGTATTTAACTACTATTCTGGCGAATACAAAGACACGAAGACGACTTCCGTCGATCCAGCTTCGTGTTTCCGCTCATTGCTGTA
GTTTCCCTCGCGCCTGGAGCCCCTTCTGGTCAGTGTCTTCCGGTCCCGA