Description :
Non Conding Region
Location :
Scaffold_1:35061- 35443
Sequence
382 bases(100 bases per row)
CAAATTCATATCTGCACCTCTGTTAATCGCACTTTGTTTGGCTCCCAAATACCTTCCTTTGACAACCATGGCGTGTGGTTATATATGCTGCATTGGGACA
GAAGTGCTCGTACACGCAGATGCTGAAAGAGCCCAGAGCGCTGTGTACTAAATGAAGTTGCAGCCGCATTTCAGTTTTCCAAGTGCTTTCTCGAGTCGCG
CGCCAAAATGAGCTCCTCGGCCAATGCAGCGCGCCAAAGTGTCCCCTTTCGCACATAAACGGACCGGGTTTTGCCAATGTGGACACATGAACCCAGATCC
TCCTATCTGCGACGTGTGCGCATTGAGAAAGCTTCTATTGCTATTCCGGTGCCATTCTACAATCTACGAGTTCATGCGCACA