Description :
Non Conding Region
Location :
Scaffold_1:35012- 35157
Sequence
145 bases(100 bases per row)
TTTATATAAATAGTGTAGTATCGTGGTGTCGACAGATAAAAGACAGTGGGGGCATAAAAGAACGATTAAAAGAACGCTTGGGCGCGAAAAAGAACAGGAC
CAAAGATCGAAGCTTGCAGCCAAAGATCCTCCGAGGCCGACGAGA