Description :
Non Conding Region
Location :
Scaffold_1:34890- 34923
Sequence
33 bases(100 bases per row)
TAACAAACTTGCAAACACACTGACTCCAGTATC