Description :
Non Conding Region
Location :
Scaffold_1:34882- 35146
Sequence
264 bases(100 bases per row)
GAAACGGCACGGCCGGATACTTGAAAACATGTCCGGATAATACCTTACTTTGTATTGATACTTTTTAGGAAAATATGCCGTAATAACGAAAGAATTGGAC
CAACAGAAGTTACGGTTCAAAATTTCGATTGGTGAAAAATTGATCGAGAAATAGAATTTACTTCTAAACCAACCAGCCTTTTTGTATGAAAATATATGGA
GCCAGCCACATCTTGGCCGAAAAGGAGCATCAAGTATATCTTGGTCTTTGTATACAGCACTTAT