Description :
Non Conding Region
Location :
Scaffold_1:34104- 38037
Sequence
3933 bases(100 bases per row)
GCAGAGCGCACGCGAGGCCGTCGACGGCGCAGTTGAGACGCAGAGACGGCGGCCTGGGGCGCGGAGAAGGAGGCGGAGGAGGGTGCACGTGCTGCTCCCA
TGGAACCGCTGTCTTCGCATTTCCTGCTTCTGCTTTAAGTGCTTCCTCTCCCGATTAAACAAACAGCTTTATTTAATTTCGACAAATACGACAAAATGAT
GGATATACGACAACACGTCAAAATCGAAGAAGTGCTTTTTTGATTATGACATTTGACAAACGTGATGGTACGGTGAAACTTTTATGAAATCTGCAGCAAG
AAGTCATTTTTTTGTTCATTTTTTGGTTGACGCCAATGTTTAAAAAGGTGGGAAGAAAATACACATACTTTGATCGTAGGAGCAACTATTTCAATATCTA
CAATTCCAGCTATGACCTTCACTGGGACTTGTGCGCTTCATGTACAGCTCCCAGTTTTTTACGCGCTAGAAAACGAATTCATATTTTGTGTTTNNNNNNN
NNNACTATATATATATTTTCTGTACTCTAATAAGGATGCAAGCACGCAAGCTGCTCTTATAATAAACGTTTTCGTGGAGAGAGTGTGCTCGCTTATAACT
TTCCCATACATTCTAGAACATGATGAGCAAGTACGTAAAATCGGACAAGCTCCTATACTTTGTAGTGTTGCGGTGTCCGATGGACGCGCGAAGATATCTG
AATCGGACACGAGCGCTTCAACAAATGTGATTCCGTCATTTTGACTTGATTAAACTAAAAGTTACTGTTTTTAGATTTTTACCTGTCCGATTTGTAAAAA
AAAATGAGCCAATTAACGACATCTGATTCCTCTTTTTCACATATCTACAAAAGTATTTTGCAGGATAAATTGCGCATTCACTCTCTCTTGAAGTGACCTC
TCTAGAAGTTGGCCACCACTACAAGCTATACAATGAAGCTGCTGGTGAGCCAACAAACACTGGCGGCGCGCGCTCGNNNNNNNNNNTCTACACTTGTAGC
GTTGCGGTGTCCGATGGACACGCGAAGATTTCTGAATCGGACACGAGCGCTTCAACAAATGTGATTTCGTCATTTTGACTTGATTAAACTATACGCTACT
GTTTTAACATTTTTACCTGTCCGATTTGTAAAAAAAATATGAGCCAATGAACAACGTTTGATTCCGCTTTTTCACATATCTAAGAAATATTTTGCAGGGT
AAATTGCGCATTCACTCTCTCTTGAAGTGGCCTCTCTAGAAGTTGTCCACCACTACAAGCTATTCAATGAAGCTGCTGGCGAGCCAACAAACACTGGCGG
CGCGCGCTCGNNNNNNNNNNNCGTGTTCTCCAAGTCGACCACGTCGTCCTCGGCCAAGGCGACCGAATCTGTGGCGACGTCGCCCGAGTCAGTGTTCATG
CTCACGGCGCCCGAGTCGGTGACGACGTCGCGCACGCCGATCTCGCCCAATCAGCCTGCTCTCTTGCTCTCGGCGTCTGGACCGCAACCAGTCACGGTCG
TGCTGCCTGCAACAATTCAGGTCGCCCAGTCTGCCAAGCAACCAAGCGCGTCATACTCCATGCCCCACTGCACTATTCCCAAGAAACCTTGTGTATCGAA
TGTCACGCGCAAGTTGGTGTGACCTCCAAGAAGCCACGAGCCAGACAGCCCAAGAAGCTGGCCGTCAAGAAGAACATGAAGCCTTTGGGGCCCAAGAAGC
CACGCGTCACGACGCCGGAACAACTCCCTGACCAGCAACAACAGTACCACCCTCGTGGAGCCGACGCTCCCCAGTACCCTCCACGAGCCGCCGTACTACC
AGCAGCACCAGCAGTGCGAGCCGCTTCAGCAGCACTACCAGCAGCAGCTCTATGAGTAGTGACAGCGTCATCTCTATGAACAACATCAGCNNNNNNNNNN
GGCCTGTTCTCTTGCTCTCGGCGCCGGGATCGCAACTAATCACGGCCGTATCGCCTGCAACAGCTCAGGTCACCCAGTTTGCCAAGCAGCCATGCGAGTC
ATACCCCATGCCCCACTGCACTATTCCCAAGAAGCCTCGTGTGTCGAATGCCACGCCGCAAGTCGGCGTGACCTCCAAGAATCCACGAGCCAGACAGCTC
AAGTAACCGGTCGTCAAGAAGAACACGAAGCCTTTGGGCCCCAAGAAGCCATGCGCCACGACGCCGGACCAATTCCCTGGCCAACAATAACAGTACCACC
TTCGTGAAGCCGACGCTCCCCAGTACTCTCTCCACGAGCCGTCGTACTACGAGCAGCAGCAGTACGAGCCGCTCCAGCAGCACTACTTTTCGCTCCAGCA
GCACTACCAGCAGCTGCTCTATGAGCAGCGACAGCGTCATCTCTATGAACAACATCAGCTACGGCACTACTACCAGCAACACGTTCATCAAGAGACCCAC
CAGTAGCCTCATCGAAAGCAAGTCGCCCCAGCGGACAGCACGCCGCTCTCAGGCACTCAGCCTATGCTTGCTGTAGTGCGTGTCTCTCTCGCCAAATACG
GTCAGCAGCCACAGCTGACTCACCGAGTGACTGACGACTGGAGTGCTGCACTGTGGTGTCTGCTGGTGTGACAGACCCGAACCACGCAGCTTCCAGCCTC
TTCGCAGACACGCTGCTCCCTAAATCGTGCCGTTGGTCGTGGGACCGGGGGCTCGAGTGGGCAGGTGGATGAGTGGAGGAGAATGAGAGAGATGCATGTG
GGTTGTTGTTTGCTTTCTTGTTCAGTTGTGATCGTGCATTACAATATACGTTGGTGCTTGTGGGAGTTCCAGCTCCCAAGATCACGAGTTGGCTGTCCGG
AGCCTTGCGACTTGGACACACCACATGCATGTTCCAATGAGCCCGATGTCGTGGACGGCAGAGCCAAGATACCGCACATCTTCATGCCCGAGGCTGTGCT
CCAGATCGCTTATTTCTTGCGATTCGTGGCTCGCTTGTGTATCGTGACTACCGCAGCGTTCCTCCAACAGCACTGCAAAAGTCAATTAGAAGGGAAAGAT
ACGCCGAGAAGTGGACCCGCCATCGGTTGACGAAGAACAAGCGGAGACGGCGCAAGCAGTGCGCCTGGTAGCGCTACTGAACAGAGAGCGCTGCGTCTGG
AAGCCGTCTAGATGCGCGACGACCCAGGTGCTCGACTTCCCAGGCGAGCGCGATTCGGAAGACAACGTCGCTCGAATGATCGCCGTTTTCAAGACGACTA
TATTCTCTCTAGATGTTTGCGTGTTTTCTTTAACGCTTTGTGCATTCGCTACTACAGTTATCGAAGTGTCTAGGAAGCCAGGAGTAAAGGTTTGTCTGAT
GGTAGACTATGCGCAAATGCGCGCAAACGGCACACATGTTAGAAAGATGGTCGACGCCGATGTACCTGTGTATGTCCACACGACCAACTCCTACGTGGAG
CATGACAAGTTCGCCATTGTCGACGGTCGGATTTCTATGGAAGGGTCCGTCAATTGGACGGGCAATAGACTGGCTAGTTCGGGCCATGTGACGATCACGG
ACGACACCAGATCAGTGCATCCGCTGTTGGCTGCGTTCAACAAGGCGCTGCGAATCAAGCCGACCCGCAAGAACGAGCTCGTGATGTGCCACTGGCTGAC
CAAGCAGTCAGTGGCTCGCCATGACATCTGTACGGCGTGTACACCACAACCGGTAGTAGTCATCAGCCAGTAGGTCCAAGTAAGTCCAATATCCATCACC
AGCCTCCCATCAGCTTTCAACTGTATGATGCACTCATTCGTTCCTGTACACAGCACCAGGTTACCAACAGCACACAACCGATCGCTCAATCATCTACAGT
AGCTTTCCTTCACCATCTCATTCAACTCATTCAACACTCATTCTATCATTTTCTAATCCGCTCCCGACCGCTTAAGTCTCTCTCCAGCAACCTCCCACTG
ATACTGCTTGAACGTGGCGGGGACAGCGTACCA