Description :
Non Conding Region
Location :
Scaffold_1:34058- 34284
Sequence
226 bases(100 bases per row)
TCACTGTTGCTTTATACACATTACGGGGTGGAATATAAGGCAGCCAAGTGCACCTTATGAGACCTTCATGAATACGCTCAATGTGCTCAAGGTAGTATGG
TTCTTTCGGTTTATTACTATAAGTGATTTACGCTCACGCTCATAGGGAAGTGTCTTGGTCGAGAGGGTAATGAGAGGTGAGTAGGGAACAAGCAAGGAAG
AGGCATCGTCGAGTTCCGGACTCGTC