Description :
Non Conding Region
Location :
Scaffold_1:33667- 33729
Sequence
62 bases(100 bases per row)
TACTTTTATTAATAGTCCACCTTTCTTAACTGTAAATAATTAAGGCTTTTCTCTCACTATTT