Description :
Non Conding Region
Location :
scaffold_1:33274- 33590
Sequence
316 bases(100 bases per row)
ATGCTACACTTGCTGTCAAACCCTCGGACGTGTGCCAATCAAATATCTGTGACGTGTGAGAATGCTGTTAACACATGGGCGCTCGCTGATTGGCGGAATC
TTAAATACACGATTTTGATTGGCGGGTATTTCTGCCGTTCAAAAACCCCGCGAACCGCAAACTACCCGCGCAAAAATCGTCAATGAGCTCAGCGCAGTTG
ACGCATCACTTGTCATCTTACGGCATCAGAGGTCCATCCATCAATATCTCCAATAAGATCTGTGGATGCTCACATTAAGTTTATAGAGTTTTATTCTCGA
GAGTCGTCTGGAAGTA