Description :
Non Conding Region
Location :
Scaffold_1:33227- 35142
Sequence
1915 bases(100 bases per row)
TTTCCCTTGGTTTCCTCACTCGGTTTCTCGAAAACTaGACGTTGATGGAAGCCACGAGTGCCACGAGTCGCCTGCAGATGAGCCTGTGGACACGGAGAGG
CGCTTCGCGACCGCAGACACGCTTCGATTCCGAGCCTAGCACCACGGATCCGGCGTCTCGGGCTGGAGCCGTCGCGAGGTTGCTTCGCCTTGGTtGTGTT
GCCGTTTCCACAGCATGAACATGGACTGTATACCAATGTGGTCCACATAGAAACCCTCGTTTGTCGAAAAACGCCATCCTGATATACCTTATGAGAGAGG
TTTTTCCCCCAAGAAACTGGACTCTAACGGTAAAATATGCACTGACTAAAGCATCGGAGTGCGATAAATTACAAGAATAGCGTTGTTACCCACATCGTAG
ATTACCGTGTAAACGTTATtCCCTCCGTCCTGACCAAACAGATGAGCAATTGAGGCATGCTGATCGCTCTACAACGCAGCCTGATCGTCACACACGAGAC
GTGCGCCAAGCAGACCTCGAAGGACTCGTTCTGCTTTCCGCTCTTTGCCAAGTGGATAGCCCAAGCGTCGCAGCGTTGCGACCCTCAGACGACGCGACGA
TTGGTCCGGAGGCCAGACACAGACAATTCCAACCGACAACAGAGCCCAGCCACTGGCCTCATGCCCTGAAGCGTTCGGATGCGGTACCGTTGAtcTCAGA
CTATCGCGAAGCACGTGAAAGAACGTCTGTGAAGGCAGAGTCGACAAAACGAAaGACACGCGTCCTAATTTAGGACTGGGTCCTCTCTCTAGCACCAGGT
CAACATGGCTTCACTTTCGACCTGAGTTGTGGTCTTGTGGCAGTGGCATGAGGCCATAATGATGATGACGAaGTAAGGTCCGGCCTTTCAGCCCTTGCAT
GGTCTATCAGTGGTGGAAGTCGCcGTCCAGTTGTGTGGCGATTtCCTGATGGTCTGCACGCCGCGAGGGgTGTGAGGTTTGGCTACTGGCGCGCGTATCC
ATGGCCGACGGGCCGCCATTTTGTTGATATGAGGCCGTGACGGCACTCAAGGGCTGAGTGGCATCCTCAGTCTCTGTCGAGACGCACGAAGCTTCTCGGA
ACTCTCGATGATTCTCGGTATACGGTTGTGGTATTGTATCTGCCGTGCCAAACTTGATGCTGAGAGCTGTGTCTTCCATGCAAGCCGGCGCTTTGCTATC
GGAGTGTGAGCGTACAGCCACCTTGGGAAGCAACCAAACAACGAACCACAAGTTCACTGTGGTATTATGCTCGGTTAGTCATCGACTGGCTTGACATACG
GCTTCCGGGCAGTGTTGCCCTCATGCCACACCTAAGTAGAGGAGTGCACTAAAACTACCGGATTGAGTCTGTCTACGCATGACTCCAGCCATCTTGCGAG
CCGCCTCTTAGCCTTCTAAGGCACTTATTAGAATAAGTTGGCTTCTGTACGGTCACTGTGTCTACGACCTCAAGATCCAGAATACGAGACGTGTATCACA
TGGCCCCGAGCTAACACCCATTAGTGTCCAGCTGGTGTCGAGCAAAATGGCAAGGGTGGTAAGCATGACGACTAGACTCAACGAATTCATGGAGAGACGT
GACGCCTAGAACCACATGACATTTTGATAGGAAAGAGTCGCTGCTCTGAGTATGAGTTGGGAGCTAGTTTCAGCTCTGAAGACGTTGAAGTGAGGCGCCA
CAGGCCTCATATTCTCCAcTCCCAGCTGGATTCCTCGCTATGCCGCAGGACCTCGGCCGTCGGATGGCAAGAAGGAGTACGCCTTCGCTACCTGCTGGAA
AGCCACCAGGGTACCTCTGCCTAGAGCTCCCTGTGGGATGTCTGCTGGGTCAAGGCTACAAACCTCACTTTCCAATTTGCTTAGCAACAGCGAAACCAAG
ACCGATACTCGACAA