Description :
Non Conding Region
Location :
scaffold_1:33090- 36138
Sequence
3048 bases(100 bases per row)
AGCCTCACTTTCGTCAGTTGATCGCTCATTAGATGCCTGCTGCATGTAGAACTGCTTTAGCGAATGCAACGCTCAGCTCGCTGTTCGTATTTGATTCCCT
TGCTGACATACCACATAGTAGATTGGAAAAACATCACACGTTGGCAATAGAGCAAGTTTCTTTCAAAGTGTTGGAGTGTGTTAGTCATCATCTGCTTGGT
TGTTATCCTCGTGGCTGTCCTCGCCGTTCTGTTCAAACTCGTAAGAAGAGAGTCCGTCGTGGTCAAAGCTGCTGATTTTTAAAGAGCTCACGGTGCAGTG
GACAATCGAACTGCTGTTGATACTTTTGCCATCCTCATCGTCTGTATCGTCCCCATCACCTTCCTGTTCATTCCGTTGTTGGTGAAGTAACCCGGGCAAG
CTACAGGAAACGAAATTGCTTGGCGGCAGCCCACTCGACAGACGACTGATCCAGGACGTACTATTGCTTCGGCTACCACTGAGCCTTTGGGGCACTTGCT
GGCGAGGATTCCTGCCTGCACTTCTTGCTCGATTGAAGAAGCGCAGGTGCTGATTATCCACGAGAACGCAGGCACAACTAGCATCATCGCCTAGACCATG
ATCCTTGGACGTCGAGAAAACGGTGATCACTCGAGCCAAGTTGCTGAACGACAGCCCCTCGCGTGCGGCCTCGTGGGCTCGTAAGATGCGAGAGAAACCG
TATTGTCCAAGGAACTTATCAATTGCTCGGGACCCGAAGCGTACCGCAACTCCGCCGCGCGGACTTTTGCCAAAGCCTCGAGAGTCCATTCTCCAGTTAC
TAGCACGCCCAGTTCTCTCCAAGGTGTCTTCGTTTCGAACAGGGTCAGCCCAGATCATGTCTGCGATCATGGAAAGTTGCGGTTTATCTGCATAATACGC
AACGTCCAAGGTGTCTAGAGCTGCAGCATTTGGCAATTTAGCAATTGTCTCCAGTAGATCCTCACTTTCGTCAATCGGCCGAGGAATCCCACCGTGCACG
CAGAAAACGTCGTTGTCGATGACTGCAGCGACGGGCATGCGATCAAACGCGTTATTAAGCTGGTGCCAGACAACTCCACCCTCACTCGCACCGAAACGTG
CCTTGCACTGTGCCAATAAACAGCCAGAGCCGTAGTGTGCCTCAAGTCCGTTGACAGCACGCGTTTCATGGTTTCCTCGCAACAAAAAGACTTTGCCTGG
GTAGAGAAGCTTGTGAGCGAACAGGTAAGCTGTGCACTCAAGAGATGAGCTTCCGCGGTCGACATAATCGCCCAGGAACAGGAAGCTACCAGCGGTAAGT
TCCAGGCCGAGGTGCCAAATATTCTCCGCGAAGAAGCGCAAGTCCGCCCAATTGCCATGGATGTCGCCGAACACGTACATCGGGCTAGATAAATCCAAAC
AACGAGCTTCACGCTCCAGCAATGCACCAACTTGAGCGCTTAGCTCCACAAGATCGGCTGCAAAGTGAAGAGAACGCAGATAAGGCTGAGTCGCCATCAT
GGGGTCTGCCAATGCTGCAAGCACTCGCCTCGCGACAGCTATGCCCCCGGTAGCTGGCACTGGAAAAGGTCGTAGTGATGCCAACACTTGCGCCGATGTG
ATGCTTCCCAAACGATCGATTCGTCCTGATGGCTTCACACCTGCGTCCGTGATGGAATACACTGTTGGAACGAGTGTGTGTGTGGACGTTGTCTCGATGG
AGGCGTTGTATGGTGAGGAAGATGATACTATGAAATCATCGCCTGTTGCTGGGGCAGTTTTTGGAGTAGTTGAAAAAACCGAAGACACCGCACTAGTAAG
TTGTTGTTTGAGAAATGCGATCTCCTTGTCTGTCTCTTGTTTTAATGCAACGTATGAGTCGCGAAGTCTCTGCAAATGGAAACCACGTTAGCCCCTTAGA
AACATCACTGGGTCATAGCACCAATTCCACGTTCCTGCAGTTCTCGCGCGTTTTGTTCTTCACGAAGAAAACAGGCTTGAGTGCAGCACTTCACCGAGGA
GTTACCACTGGGTGACAAGGTATCTGGTGGATTGCTGTTCTGTCCGTGCTGGTGAAGCTGGTCTCCGATGGTGCAACTCATCTTCACCGTTTCTTCGCTT
GTTCGAGCCGTGATACTTCGGTCTGCCAACGGAATGCAACGAGGAATGTTGCAATGCAATGGTGCCCATGTTGTCCGCTGCAACTGGTAACCCCGGAAAT
AGAATGGAGCGAAACCACAAGTGGCCAGCAAAAAATCTTCTCGAAGCGTCATCCTCCTGCTCGATCCGAAGTTCCATGATGAGGTGGTGGTCCCTGCAGC
TCCTGTTGCTGCTTGGCCTTCTCTTGCAGTCTCTAGAGTGTGGTTGCACGAAGACGATTGACTACGAGGCCTTGGAGAAAGCGTGGGAAGCTGGCGACGA
CGAGCAGGAGCTGCAAACGGAGGGAGATGAGCGCTATCGACAGCTTGCAAACAAGTAAACTATGATAAGAGGAATTCAATCCGTATTCTTACTCCGTATG
TATTGTCAGGAACGAGAAGGATGCGAAGGCACTTGGACCCCAGATGATCTTCGTGACAATGAAGAACGGACACAGTGAACCTCTTCCTGACGTTGCATCA
CGATGGAAAGAGGTGAGTGCAGACATAGCAACACTGCTATGCGATACTTACACTCACATGGACTTTAAGGCAGATGCTGTGGAACGGTGGTGTCGAGGCG
AACATCTACGAGGTCGCCGACTCCAAATTACTTGTTGGGCTGCAGAAGGGTTTTTTTGTCGATGATGTCCGGAGGTTTCTTGACGAACAGCACGAGGTGA
AAGAATACGAATGGAACGGTACTACTTACTCAAAACGCAAGACAAGAACTAACAAGTCCCGCCGCAAGAAAGCAAGCGACCGCGATGCTAAAGATTCGAA
GCGCAGCAAGGGCTTGCACGTGAAAAGGAATCATCGTCGCGGAAAGCCAACGCAAACTGAATTCGCTGCGAATGATGAGTTGTAATTGATCCATTCATTG
AGCTAACTGATAACCGTTCGTCCGTCGTGCCTTACGTTTGAGCCGACT