Description :
Non Conding Region
Location :
Scaffold_1:32931- 33749
Sequence
818 bases(100 bases per row)
AGCGCAAATGGTTACTTCATTATTGTATCGCACAGGCGTTTGACAGAGTCGTTGCATATTTTCAGCCAGCCAGCTCGCTCGCCTACCTGGGCGAGATCTG
CAAGTAAACCTGACGCAAGTGTTGTACTTCCACGTGTGGTTGAGCGGCGCAGCTGAGATGGCACTGCTGGCTCCCATTGGGTTTCTGCCGCTTAGCCACT
TTGCCTCGCACTCTTCACTCCACCCACCCACCGCGCGTTCATTTCGAAAACCGCGTTCATCAATTACGTACCTAGCTTGTTGCACTTTGTTCTCGCCAAA
AAATCAGGAGGTTGGTGTTCCTGTGAGACTTTATTCTACCGTCACTCTGCATTTCTCAAACTTGATTCTCTACCAAACCTAAATCTCACAAATAAATACC
CCTCTTAAAACAATATCATCGCGTTTAAGAGGGTCTTCGAGTAAAGGAAATCAGTGCGTACGCTGGTGAGATAGGTTACAAAAACGAAAACAAAGGACGT
TTCGCTTCGCGCATGACCAGGAAAAGGAAGGAAACCAATTGCCGCGCTCCTTCTCTTCTCTCCGTCCATCGTCCCACCCACCCACGCGCATTCGCGAGAG
CGAGAGAACAGAGGCCGAGTCGCCTATCTGCGCATCGCAGCTACGAGCTCACTACCGCCACCTCCATTGCTGCATATAGCTGCAGCCACTTTACAACACA
GCACAACCCAACGCTCGCTCTCTCTTTTGGTCTGCCTGTCCTTTCAACTGCCGTTTACACGCACACCTCCATACCTGCAACGTCTAAAGCGAGAAAGAGC
ACAGTGAGCAAGCAACAA