Description :
Non Conding Region
Location :
Scaffold_1:32879- 33132
Sequence
253 bases(100 bases per row)
GGAGAGCTCCCAGTGGAAGTTCCACCGCCCCACAGGAATGTTCGATCAACCATACCCTTAAAATAAGTCGACACTTGCCAAATGCTCGTTCTAGTTTGCC
TCCCACCGTCACCTGGGACGTTGCTTGAAAACGTTTCGCTAGAAAATCTGCTCCTAAACAgacaagaaaaaaaacaagaatGCAGCTCTGGCACTAAGAG
TAGATGAGCCTCTTTAAGATTTCCAGTGGTAATCGCAATTACTCATTTGTACC