Description :
Non Conding Region
Location :
Scaffold_1:32645- 33497
Sequence
852 bases(100 bases per row)
GTTGGCGGCTACTCTGAGAATAGCGCAATGGCCCACAAGGGGAATGGCGCCATATGGATTGATGAGTGGGGGAGCTGGGCGTAATACGCAACACCACAGT
GATGGTCTCTGCTCTCCAAATGAGCTGGAGGATGCTCATTGGCGGAGCGGAGACCGAGCCATCAATGCTCACTCATCGAGCAAACAGATGGTGGAGATGG
AGCCACAACATCACGTTGAACCTGCACCCATAAGTAGACCGTGTTGAACCCACAGGTTGGTGGAGGTCTCAGCGTGCATGAGGGTTCTCTTATCACTGCC
AGTAGCAGATACTGGGTTCCAGTCAGCGGTCGCCGTCGCTTTGCGTCACGTTTAGGTGGACGGAGCGCTCCGGACCGCACATGTGGAGCAATCGGTTGAG
ATCGCGCGACGCTTCGCGTGGATATGCCCCGCGCGCGCTCTTTCGCGATGAGGGAGCGCTGAGAGCGTGAGGCGAAGCGACCTGCAGTAGTGAGTTGGCA
ATTCCACAATTTTCGGTGTCCCGCATACGTGCTAGAGCTTCAGCTACGCAGTTCAGGATCCAATGGGGAAATCTGTGCGCAAGTACCGCAAGAATCGCGA
TTACGAGTACGCCGACCCCAGCACGGCGAGCGCGTACTACGACGATGACAAAAGCTCGGAGCACGCTGCCGGATCAGTCGTCGACCACGACCTCCTCGCG
TCGCCACGGCACTTTATCCCGTTGGAGGAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNCATTCGTGTTTCTCCAGGGTGGGTTCGTGA