Description :
Non Conding Region
Location :
scaffold_1:32640- 32707
Sequence
67 bases(100 bases per row)
CAATCTCACTTTGTCACGCTAGTGTGGTAAACACCATATTTTCACCAGAAATCGGGCGTGTTCAACA