Description :
Non Conding Region
Location :
Scaffold_1:32640- 33063
Sequence
423 bases(100 bases per row)
CAGGAGTTTTTGTATTGACAGCAGCTCGTACACGACGGCGATCATATCACCATGCCGACTTAGTGGAATTGACGACGGAAGTCGCTGCTTGCTATCATGC
CAGATTGTGGTCATGTTATATTTTCTCGGTGTTATTTTGACAAATGTACTGACTATTTTTACACGGTTGTAGTGACTGCGTTTCATTGCGAGGTCATAAT
GTATCTCTAACTCTTGCTGGTGATGCCAACGACTTGATAAACGCAATTGTACATTATGGCGGATTCATCGATACTCTAATCTCGTCGAAATATCAATGAT
GTGACATAACAATTTTAACCCAAATATTTCCCAAAAGCCATAGAAATAGCCGAATCGAAAGCTGGCATCGACCGAAAGTTTCAGTCCAGTTTTGAACATC
ATCATAAAGTTGATGAATCAAAA