Description :
Non Conding Region
Location :
Scaffold_1:32577- 33016
Sequence
439 bases(100 bases per row)
GCGTCTCTTCTAGTGTGATTGCATCCGCTGACGTTCGATCAGGATACCCTGGAAGCAGGTTGATCTTGATGAGCGACCGCGTCGGATTCGTCGACACGAT
CTCCGCCGCGGCATCTGATTGGTCCATGGAACCGCGTTGAGGTGACCAGCATACACCATTTTTTATAGTGGTAGAATAGTGTGAAATCGTAGGACAGGAC
ATAAGAAGGTCGTGCGCACGGTGTGTGCGCCGTACGCGGTTGCTTTCTGCGTGATATCCAATCAAGTACGTCGAGTCTATCTCGTGTAGGCTGCACCGCG
AACAGTAGAGGGGTCGGTCGTCGCGGATGTCTCCAGCGCATACTATTTCGACCATCCAACAGAAGAAACGCATGGATATACGACAATAGTGTGACGCGCG
AAAGATCGCAATGCGGAGCTCAGTTCTGATTTGCGACCA