Description :
Non Conding Region
Location :
scaffold_1:32517- 32589
Sequence
72 bases(100 bases per row)
GCTTCAGCCGATCTAGACGCCAACATGGGAAGTAGACAAGCAAGAATAGACATTTTTGTTCCTAGAGACAAT