Description :
Non Conding Region
Location :
Scaffold_1:32303- 32825
Sequence
522 bases(100 bases per row)
TTGTCAAGTCTCTCAGTCTTTGAATGGATCTGAAGAGCTTTTCTTTTGGGTTCTCTGTCTCTCCTCTGCTGCTCTGAAGACGGAACTAAACTGAGCCTGG
CGCCACCTACTTTGCGCTCCAAAATGGAAGAAACTCCTGTGTCGTGTTTTCGGAAAGGAAGCGACTAGAAACAGCAGTCGCTGAACCCACACTCGGCCGA
AAGATCGCGTTCCCGCTTGTCGCGCGCTCGACCACGTCCCGAAATAGAGCTCTGTACAACTACGTTCGTTACCACAACGCCTGCGTTTGTGGTCTTGGAC
AGAACCTGCGAGCGTGGGGTTAGTGTCGATGGCTATTTACGGCTGAACACTATTTATAGATGCCGCCTCTTCTTAACAGCGCGACCCTTCCGGCGCTAGG
CGAAATGTCGCGCTTCTCCAATTCGTACTTAATCGAAGCAATCAGATAATTTGATTATGTGCACCACATTAATTCACATCGCGATTCCGGCCAACCAAAC
TTGCACTTGCATCACAGCAACA