Description :
Non Conding Region
Location :
Scaffold_1:3230- 5331
Sequence
2101 bases(100 bases per row)
ATGAAGAGGCGGCAGGGTGCAGTGGAGAGGGGCAGGATAGCACTGAAAGAGATTCAAATGGGTTATGAGAAGCGGGACGTGCTCAATATGGATGAGACAG
CTTTCTTGGAACTACAAAGCTACCACTTCACTTCGTTGTATCTTTGGAAAAAACCGCGCTGCTTTAATAAAAACCATACGACAGCACAAAAAATGGACGG
ATGACTTCAACGCTCTTTTTGTGCTAGTTGTCGCAGTTGAACGAGTAGATGCGTGTTTCGGGTCACCACATCCTCCTTCTTGTCGACAACGTCTCATCGC
ATCGGATCGACGACTTGCTATCGAAAGTGAAGCTTCAGATGCTTCCGCCAAATAAGACTGCCTTTCTACAGCCTCAAGACGAGGGAATAATCATCTTGAT
TAGAGCCCAGATTGCCAAGGTTCGGCATCATCCTATTGTTGACCGGTCCAAAGGTCTTCTCGAGAAATTGCGAACTATCCCTGAGAGGTACAAAGAAGAG
GATATTGATTGGCTCACTTTTTAATGTTGATGTGCTATCCGCTATGCAGTGGGCTGAATTAGCAAGGCTGTTTATCACGCACACAATCATAGCGCACTGT
TGGAGACACACACAAATATTGGATGATGACATGCAGGAGTTGTGAAGGGCTTTCATAACCTCCAAACGAGCGTACTGACGCGGAGTTCACTCGGGATTTA
ATTTGTTTCATATCTGAAAACAGGAACAAAACTATACCTTTCTATCCTTATATCCTTATAATATATTTACCTCTGAGATATATCCATAATTGAGCTATTT
TTGATGGTTCCCAATGGAAGGACGTCTGTATAGGTTCTCTTGATCTTTAATCGCGCTTGCGAAAAGCTGTCGCCAAAACAGGAGCCTAGAACAGCACCAA
AAGTGATATGCGACGGGTTTTCGGTAACCGGATATCCTTGGCGTATAATGCAAGAATCAAATACATCGAGCTGTGCTAGCAACGATCCGCATCTGCTTCG
TTGTTACACGAATGTGCATCGGCCACTTTGACATTCGTATCCTTTAACCAATCTTTGGAAACGGCTGGTGCGAGCAAGAACTTTCCTCACGCTCGCAAAA
AGTTTATAGAAAATAATTTTCTTTTTTCTTAATGTAACGAAATATTGCCAGGAATCTGATGATAAATATGCCTTTAGGCTTTCCTCTTTTTTCGTTACTT
GGAATAGACGACTTCACATAGTTTTTTTAAGGGTTTTCTAGAAAATGGGTTATACAATTCATGTTCATTTGACAACGTAAAACCGTGTATGTAATTCCAG
CTGCAGTCAAAGCAATGTCACTCGACAATCGGAAAATGCTGCAGAAGAACGCAATATATGGAGAAGACGAATCATTTCAATAGCTGTCACTGTGAATGGG
TTTCCACCGAAGCCTCCTCACAGTATCACCTAGTTCGTAGATGTCGTCATCTCGGATTTCTGTGTGCCACAGCAGTTGCTAATTGTCGTGATAGTGATCA
TTTCCCATGAATGATTTGCCCATTGAATATTTACATGTACCTAAACTTGGAACAAGACTTCAGTCTCTCTCTCAATATTTTCCTTCTTTACATTTGCGGC
AGCGGTTCAATAGCTCGTCAAAACTTAGGCACTACACGACGAGTCTTGAGCCGTACAACTTGTGCTGAAAGTTTGGATAATAACGGCATTTTGAGGCCGT
GGATATTCATGCAGTAGTATTTCGTGACCACTAGGACATCTTGACCAGCTTTGGTATGAGACCGATAAATCATATGTTGCCTGGATGTCTTGCTCTCATG
TGAAATATTAAATAGAAGTCTTAATACACCCTCTTAATCAATAAGGCAAAAATTATAAGATTCTGTGAGGTCTGGTGTATGCTATGAAGATGTGAAAGTG
TTATTGTCTTTACCTTTTCCTGACTATACATTCTACATGCTTAACCCACCAGCCACGTCAATGTGTTCAGAGCACATCCTAAGGTAACCTACGCCTTTCT
CACCGAGGGTGGTCGGCCGAAAATATCTGTTTTGTCAACTCTTTTTGATACTCCTCCCCAGCCGTCGGACGCTCGTCCTTTCGCCATTCTCGTCACGGAC
T