Description :
Non Conding Region
Location :
Scaffold_1:32223- 32868
Sequence
645 bases(100 bases per row)
ACGCCGGCGGGCGGAAACCCCAGCGGGCTGTTGCATTTGCTGCGCGGCTGCAGCAGCGAGTAACCAACGCGCGCGGGCGAGCCCGGCGCAGTCGAGTCAC
GTCACGCGCGCGGCTCGACACGTGCGTGCCTCGGATTTTTCCGTGAAAGGCAACCTCCAACTGCCCCGGGCGAACCGCGGCCCCGATGCGCGACCTGAAA
TTTCCGATGCGGGCGGACCACCCACCCACCGCGCTTCGGCCGGCGCCGGCGGGGCCATCTACTGCTTCCGGAGCCGCTCGCGCTCGGTTTCGCGCAGGCA
TGTTACACACCCGCCATCTCAGACGCGCTCCGCGAACGCTCGGTCGCTCGGTCGCTCGGCCGTTGGAAGAGATGGTCTTCAGCGGGGTTGCTTGCACTCG
CTGCAAAAGGTTAGACACTCGCTTAACCCCCACCCGCCGGGGTTTCCGTCTTTTTGCGAACGGGCTCTTCTGTGACAGGTTGCCTTCACTTAAAGCGAGA
GGACAGTGACGTAAAAATAACCCCCGCGAGCCGCCGCCCGCGTCCGCAGCGGCTTCATTCCCCAATTTGCCGGCTGCCGCGCAAGTGGACGACTGCCGGC
CCCGCGGAGCTTCGCTAGCTGCAACCGCCCGCTCGCCTGCGCCCA