Description :
Non Conding Region
Location :
Scaffold_1:32139- 32459
Sequence
320 bases(100 bases per row)
CCGCGTTGCGCTGTTGCAGGCTTGCTTTTGCTTTTGCTTTTGTAGGTAGAATTGGCATCTGGCCACCCAGCTATGCAACATGTCGATATGGAACAGAGAT
CACTCACTGAAAATATGGAGGCGAGGCGATATGCACATAGGTTTGGTCGTTCGTCGTGTGCTCGATCGTGATCGTCATGGTTTGTTCTCTTTGGAGGCAT
CAATATTTTGCAGTGCCTTGACCTATTTCCAGAGGGCCGTTGACGCCATGCAACAGACAGACTGGCCGAAAGAACAACTGAGACTTGAGTTGCTCGCGTG
GAGCGAGTCTGGAGCAAAGA