Description :
Non Conding Region
Location :
Scaffold_1:31857- 33900
Sequence
2043 bases(100 bases per row)
TGTTGGGCGTTTTGCCTTTTTCTTCCTGCCTGGAGGCTGAAACTTGCGCTAGAAGGGCAGCACGATTCATTGCGGTTCGATAGCAGTTGGGCTTCGTGTC
CATTTTCACAGTGTTCTGCAAAGATCTCGCAATAGTGAAAATGTTTCACTTAATTCAGTACTAAAAGGCTCCGACTGCTGTCAAGAGCTAAACAAACTCA
TATGCGGAAAGCTGACAATTCTCTCTCTCTTCTTTGTCTTTTAAATATGTCACAATGTTCATTTACGCCAGTCTCGTTAGTCCACCGTCAGCTGCACGGC
CTCCATGAGGCGACTCCAGTCGCCAGACATGCTCTGCGGGTACACGCGGAACGCAAAGTTGCCGCTTTGCGCAGGACGAACGCCGCTGCCTTCGGGTCCG
CAGGCTTCCCACAGAACGCCGCGAGTCTCAAATTGGTGCTCAAAGTAGCCTCGACCAAGCGAGACCGCAGCGTTACCGAATCCGTTGGACGCACCATTGT
TGCATGCGATGAGCACACGCTTCACGCACGCGCCTCGACCGGCGACCACAAACTGGACGAACTCAACGGGGCCGACGTTGTCGAGCGCGAGCGTCGACTC
GATCCACTTGGACGAGTCTGCTTGACGGTCAGACAGCGTTTCCCCCGTGGTCCACTGACCAAGCGACTTGCTTTCCACGGCGATCGACTTGTCAACTACG
GCGTTCGGGTCGTCGCTGACAGTCTTCACTTGGCAGAGCGCAGCGGCGCGGGTCATATTCTCAAACTGGTCGAACACAAACTTGCCCGTGATCCATCCGT
CCGCGAGGCCAGCATCAGCATCGTGTTCGTTCGCGTCGAAGCACGTCGCGGTGACGTTTGCTGCTGCGCTGCTAAGCAAATCGACATGGGGTCTCAACGC
CATGGAGTCGTAGCTGCTGTCATTGCAGTAGGTCGAGTAGTTGAAGCCGCGCGCCGAGGCGATCGCTGCGAGTTGTAGGACGACGCTCGACAAGAGGCAA
AACGTGCGGGAGACCGCCATTTCCACGCGGTAACGTCGAGACTTGGAGGGGGTTCGATAATGAGGCGCTGAGGCGCACGGCTCAAAAGAAAGGCGTCGCG
ATGTGGGCCACAACCAGTGGCACAAGGGAACTGGAGCATGAAACTTTCAAGACATCACGGGTACTGGGTACATATGGCGACGCACTTTCAAAAAAGAGAC
AAAAAAAGGACAAAAAGAATGCATTTCCCCTTTAATAAGGTCGTTGAATAAATAGATCTTTTCCATAGTCTGCATATAAACAAATGAATACAATACTAAT
CAGTGCTACAACAACCTCTCAAAAGCATTCACAGTTGTTGTTGGAGTGAGCGTTGCTGAGGGGGAAGTCGCAGACGCGGGACTTGTAGAAGACCTAAAAG
GACCCATACTAAACAAGAATGGCCAGACAGCCTTTGACGTCAATGCGGCGGTTGTGTTCATGGCGCTGATGGCACGCGTCTCAAACCAGAGGCAGGGCGA
ATGAATGGATCGAATCCGGAGCCCCCGATCGCTTGCTTGATCTCTGGCAAGATCGTGTTAATAGACGGTAGGGGCTTGAACGCTCAATTCAGAGCAATAC
ATGACCGAGTGCACCCATATGAACCCCATCGTTTTTTTCCGTTTGAGAGCATCTGCAAGTCAGCAGCTTATATGTGTACTGTAGACAGCAGCAAGCCGCC
CATGGAAGAAAAATAAACATTAATGTACCGCACTACGCTTAAATTTGCAATACTACACCCTTATTGTGTACAACCCGACAGCTCCATTAAAGTGCATTCT
TCTTACCTATTTTGTTTTACTCCGACTGGTGTTTAGTCCCCACACCGTCAAAAATGTCGATAACTTACAAAATGCATATGCAATTGCAGCGGTCTTCCGG
TACGATCTGGAACATTCGCGGCGCATGCATCCATGACAGCGTGTCATTGCCGCTTCAACTACTAGAAAACGAACGGCTCATTGCGCATTTTGCGCGGCCG
AGAGCAAGCCTCAGAGAGAGAGACAGAGAGATCAAGACCAAGA