Description :
Non Conding Region
Location :
Scaffold_1:31791- 40771
Sequence
8980 bases(100 bases per row)
GTCAGATCGCTGTCATAAATGGACCGAAGAACCTCGAGCTCTTGGGTCTGCAGCTTTCGTGCTTCATCTAAAGTAACAGGGTCATGAGTAGCAGGAGTAG
TGTCGCATATCGCCGCAGCAGAAGCGTGAGCGTCTGGAAAGACACAGGAAAGAAAGTGAATATTGTTTGACTATACATGATACAAGAGAGGGAAGAAGGA
AGAATGCCACGTCTGCTCAGCACTCTCTGCAGTTTGTACCTCTCTTCTTAGTCTTCTTGCGGCCCATGCACGGACAAAGGAGATGGTGTTACTTAGACAC
TCGAGTAAACAAAATGGGTTCACAATGCACGAATGATGATGCAGCTGAAGTAACGGTAGTAATCCTGTCGCGCTTGAAAAGTAGTGGACGAATAATACGT
GGCCACGACTGGACAAAAATATCGGCTCAAGATCGACTGACGGCTGGTGCAAGTTGTCAGCCATGACATTCAACGTCTTAAAAAACTTCGATCCATGTTG
CACCGCTTTTACCTCTTGACGTCTCTTGCTACAAATGCCAAGTACGTCGTTGCTATTTGTAAGTACACCTCATTCTCACAACGACTTGGTTGAAGTTCGA
GAAACAAAGACCTCTAACATCTAGTGACGCGCGGCGATCAAGTATCTTTTGACTCAGTCAGTTAACAAGTATCGTGCATTCAGTCAAAAAAGGAGCGCTT
AATAGCGACGTGAGGAGGAGCTAGGTGCATGCCATGATCGAAAGGATTATGCATCTGCATTCTTCCTTCTACAATGCGCTCCCCTTGATGCTGTTGCCTT
TCGCCAGCAAAACCAGTCTATAGCAAACAAGTCGGTCTGACTATTATCGCCGACCTTGTCACGGACTAACGCTACGCCGAATATGGGCTATGACTTCCGT
CTTGCTACTACCGCGGTACGAACTCTGTTCCAAGCTCGCAAGTCGCCTCATAAATAAAATATCGTCTCTGTCGAAATATGTTTTTTGACAAGTATCTCTT
GGAGATGCTTGAGCGCAAGTGATTTCTTACAAAAATGGAAGGTGCCCTTCCATTTTTGTCTGCGTTTTTCTTTTGTCGGTCCACTGCTTCTGCAATGGAA
TCTTGCACGAAACGGACAACCGTTTTGCGAGCCAGTATGAATTCATCTGCTGACTCGCTTTCTTTGACTATAGTGCGCTTGGAGCGCACTGTGGCAAGAT
CAGTGACCTGGGTAGTTAGAGCATCCTCGCTCTTACTTTCCTCTTCTTCACCGAAGTCGATGTGATCGATATCGGCGTCATACGTAGTGACCTCGTGGTC
AGTACGTGATGAGTGAGAGCCGAGTTGGCGTTCACTCGAACGATTCTCCCCCCCCCCTCAAACTATAGTTACACTCTAAGAAGGTGGGTAGGCGTGGGTG
GCGCAAGCCATTGACGAAGAACGGTGTATGCGTCGTCGATGCATGCACCGAGTTGTTGATGGCGAATTCCACAATTGGCAAGAATTCGCTCCAATTCGTA
AACGAATGGACATAACCCCGAACGATTTCCTTAAGAACGCGGTTTGCACACTCTGTCTGACCATCTGTTTCAGGGTGGTCAGAGGTCGACATCTGAAGGC
GCGTACCGAGTGTTTCGAACGCGGATCGCCAGAATTCTGCAATGAACCGTGGGTCTTGATCAGAGACGAGTTCACGAGGCAACCCATGAAGACGATAGAT
CGTGTCGATAAAGACACGGGCACAAGCCGATGCGTTGATTGATTCGGGTACAGCAACCAGATGTATCATTTTACTGAATCTATCAACGTACACAAGAATA
CCTGTATTCTTGTGTGGGTCTGCGGGGAATCCAAAGACAAAGTCCGTTGAGACTGATTCCCAGCATTCTGCCGGAATGGGCAAGGGTTGCAACGGCGCAC
GAAGTGTAGGACCAGACTTCACTTGTTGACATACTTTGCATGCGCGGACGTACTTACGCACGAGCTGATACTGGCGGGGCCAGTAAAAGTCGCGACTAAC
TGTGAGATACGTCTTCTCTAGACCAAGATGTCCACCAGTAGGTGCATCGTGGTACTCATACATGACGCTCAGTCGCAGGTCACCATGGTCCGGTACGACG
ACACGAGGCGTGTAGCCGGCAACGGCTGAATACTTCAGTAAGACATTGTGGACTGTATATCTATCCGTGGAGGATCGATATACTGGGTGCAACCTTTTAA
GGGATTGAAGGGTTGGTTGCGAGAGATGATCTATCAAACGCACCATCGCCGGATCGTACGCCTTGCGTATGTATTCGAATAAGGTTGACGACGGGACACT
CGACGTCAACACCGCGACAGTGGTCGTACCAGTGTCGGGTTACGCATCCGGTTCGAAATCAGGCAGAGCATCAGCGACGACATTCAGTCTTCCTGGCTTA
TATTCCACGGAGAAATTATACTCCGCGAAGAACGACAGCCACCTCGCCATTTGCTGCGAGAGGTGTGGACTGTTAACGGCCGTGCGTAAGGACGCATGGT
CCGTGTAAACGATGAAGGTTCTACCACCTAGCAGGTAGACTCTGAATTTCGGCAAAGCGTACTTCATGGCAAGGATTTCCTTGTCATGGAATGGGTAGTT
ACGTTCAGCCGGTTGCAGCTGACGTGACTGATAGCAGACGACACGCTCAGCACCGTCTGTGTCGTACTGCATTAGTGCACATCCGATGGCAAAATCACTT
GCATCGCAGACCACATGAAATGGTCTGTCTTGGTCTGCAATCGCCAAAACTGGCGAGCGTATCAAGCAAATCTTGATACCTTCGAAGGAGCGCTGGCAAT
CAGCACTCCATGCCCACTTCTCGTTCTTTTTCAATAAACGAGAGAGATGAACAGTCATCTCGGCGTAATTGTGCGAGTATTTGTGCAAATACGCCGCTAG
GCCAAGAAAATTTCGAAGTCCTTTTATGTCGGTAGACACCGGCCAGTCAGTGATCACCTTAATCTTTTCCGGATCGAACCGGACGCCATGGTTACCCACG
ATGCATCCAAGAAGTGGTATTTCGCTTGCAGCAAATATGCATCACTTGAGGTTGGCGTACAACTTATGCTCAAGCATCAGTGTAAGAAACTTTCGGTCGT
GGAGTCGGTGAACTTCCAATTCCGTCTGTCCATCCATAGCCCGGCTATGAAAGAACACATCATCGAAATAGCTAGGTGCGAATTCTTGCACATATATCAA
CAGATTCGTAACACATCTATTGAACGTATCAGGGGCATTACTCAGCCCTTGTGGCATTACCAACCACTCCCAAAGCATACCGCTTGGGGTGCTCACTGCT
GTGTAAGGAATGTCCTTTTCACTCATAAGGATCTGATAGAACCCGTCCATCAGATCCATCGATGAAAAGATGGTACTCCTTGCCATACCATCTATAATGA
CATCCTTTCTTGGTATCGGTGTTTGAGCCGGTACAGTTGCAGCATTCAACTTGTTGAAAGCATGTACTATCCGCCATCCTCCTGTGACCTTTCGGACACA
GAAGGTCGGAGAGCTATGAGGGGAAGTAGATTCCCTCACATGACTCGCTGCCAACCGATTGGCGAAGAATTTGTCAATCGCTAGTACTTGTTCACGAAGC
AGTGGCCATTGCTTCATGACACAATAATTTGAACCTGGTTTCAGGCCGATCTCATGACGAGTACCCTTATCCTTAGGTAGCTTGCACGGCACTGTTCTGG
GAACACATCTCTGAATTACGTCAAATCATCGTAGAGAGGATTTGTCTTGAGCGATTCCCACGATTGGGATGTATATCGATCAATCCGAGTCTTCTCATCG
AGGACACTCGTCCATTGAAGAACTGCTGAGAACCCTTTCGTTCTCAGCAAATACCATTGCCGACCGAATATCGATTACGTACTCGTCTTCCGCGACGAGT
ACGCAAATCTGCTTGACTTTGCCACTACGCAGATCACGCATGAACCTCTTTTGGTTCAGAGGGGGGGGTAACTGAGTGATCTCCGAAGTTGTCTTCGGAG
GCGCGATCAGATCATGTGTATGACTACCTATGCTTGATCCGTCGTTAACCAGAACATCCAATGTCTCTGTTATCTCATTGGGAACGTATTTCCACTGTTC
ATTGGGGACTTATTCTCTCAACTCTAGCCTCTTGGGCTACTTCATCTCCGTACTGACAATGGTTGGCAATCGGTTGGTCATGATCTGGGTGTTTCCCTCT
AAGAAGACAACCACGCCCTGGTCCGCTCGACTTATTCAAGAGGTGGGCCTTCGGAGTTTCGTACTAACTACCGAACCACACGTGATGACATCGCACCTAC
TTGTAGAACATCCACATAGTGGTGGAAGCTCCAAGAAGTTCATCAAATGGGCGTCTGGTGAACAAGCGGCGGGCATATCGACACTTCTTCGATGCCAGCT
GACTTGTGGCTCGTACCTTCTAATCCATGGTAAACCAAGGATAAAATCAAGTTTTTCATCCAAGTCCAAGACGGTGAAGTCATCATCGTATTGGAATTCT
TTCAGTGTATAGGAAATCCTCACTACACGTTTCATCACTGTTACGGATGCGAATGTCGCGAGGAGTACCGTCACCCTCGGTGGAGGGATCTCGCGCTCGA
TATAGTTGAGCTCGCTGTTGTCCAGCGATTGGCGTCGTACAAAGTTGTTCGACGTCCCACAATCGACTAGGGCTTGAAGCGGCATATTTCGTGTCACTTC
GAGTTTCAAGGTAATGAGGGAAACCTCATTACCAGAAGCAGCAACACACAATGATTGAGTGTTGGGAGAAACTTTCGTCTAGAGGCCTGCAAAATCCCTC
GACGTTGCTGGATCAGTAGGGTGCTCCGCACCTACTGACCCTGACCATTTCTTGGCTGTCCGTTTCGTTGTTGCGTCTTCGCAACAACTACGGACCCACG
CCTTGTACCTCTCTTGGCCGTTTGGTGGTTATTGTTTCCTGCGGTACGTGGTACCGCTCTCGGGGCACTGCATTCGTATGCATAATGCCCTGTCTTCTGA
CATCTATTGCATTTTTGCAATTTCTTGTAATTGTTAACACGAGAGCTCTCGCTCCCCGCGTGACAGAGGTCCATTGGTTCTGGGCCTTCATTTTCCTGTG
TTCTCGATGGACGATAAGAATTCAAATTCGCGTGAGCCTGTATCACGCTGAAGTCCTCCTGTTCCGCAACCCTTATCGCCTCTTCTAGGGTGTTGAATTC
CAACCGGAACTGGTAGGTTTTAACAGGACCATCTGTCAGACCCTGCATGAACAACGTAATCAACTTTTGTTGATTCAGTGGGTCGACTGTTATGCAACTG
GTAAGGTGACGTATGTACTGAATGTACGAGTGTACGTCACGTTTATCTTGCTTAATTCTCAGTAGTTCAGAGCGAGCCCTGAACTCAGCTCGCGGCGGCT
CAATAGTTTATCTAAGCAGAGACTTGAAGACTTCCAACGACCCAAAGACATAGGTCGTGTAACTGAAGGCCCAAGGCCCAAGTGTTCGCACGCTCTGCCA
GTTTGATTGAGCAAATGTGACCTGCATTTGCTCATCGATGATGTGACGAGCCCTTATAGCGTCATCTAGATCAACAAACCATCTCAGCAGGGAATCTTCT
TCAGCTGCGTTGTATTTGGAGACGTCAATTTTCAGTGATTCGGGTCGACATGAGTGTGTCGACCCGGTAGCAGTAGCCTGCTGCTGTCTCAACAACTCGA
ACTGTTGAGCACTCTGTCCTCTCAACAGCTCTGTCTGTTGAGACCCTTGTTGGTCAAGCAAGGCTACCTTTCCCCGTTCAGCCTCAAGTTCATTTTGAAT
GAACTTGGCGATGGTGGTGTGTCACCCGTCTGGACCCAGAGCGGATAGCATTGCGCCTACGACTTCTTGCTTTATTGTGGAACTCAAACGTTCGACGGCA
TTCCATTCGATTTGACTCAAATGGGAGTAGCTCTCGTTCGCTGGGTGGAAGTCTTCCGCTTCATCATCTAACATGTTCGTAGTTGTTGGACGAACTACAA
AGTGCTACCAGGTGTAACGGGGCACCGGTCGCTTGTACTGTCACAGTACAAGCTACTTAAACTGAGCACAGAGTAAGGTGCCTCGAGACTTCACGTACAC
GCGTCGTGCAGAGGAAGGTTTCAACACGAGATAAGGGGTAAAAGTAGAACTGTATTCAGTATAGTTAATCTCCTATTAATAAATCCTATTTAGTCTTCTT
TTTAACTATATCTAAATACAAACATGTATTGTAACTATCTGCTCACTACTCATTGCGTTCTTCTGTCGTGGCTCGGCTTTATTGGCTGATACCATTAATA
TATATCAACCAATGAGCAGTGTATTACTTCTGCAACACAATGTTGCTTATTAAGCCAATATTGTGCGAATTTTTTTCTGTTTGTCCTAACAGAATATTCA
TGCTTGATATTTACCTTGTGTAAACTACTATATAACGGAGGCACCCCGTTACAAAGTGAATGCCGACCCAATCCTACTTTCCCTCTGTGTATCCGTAAAT
AACACTCGGTATGCCTTACACGTCGTAATAAATGCGATAGGCCGCCTCTTCGTCTTAGGTAGGTAAGCATTATAAGTGTCAATCTTTGATAATGCCATTA
CTTGCAATCGCGTAGAGAGTGCAAGTCACACACACTCACCAATGCCCGCGCGCGATTGGTTCAAAAGAGACCAAGTGCGAGCAGATAGCAAGCAAATGCT
TGACACATAGAGGCAGAGAATATCTTCGCACCTATAGCAGACAGTAAATGTGAAGTGGTTTCATCCGTAGTACTTGATTGCGAGCCCGAAGGATGGATCT
ATTAGTAAGTGTGCGCAAGGTGAATGCCGAACTTGTTTAACATCGTACTAATCTGCCTGGGTGTCTGTCTGTGTGTTTGTAAATAACACTAGCTGTACCT
TAATGTCGTACTAAGTGTGATGTAGCCTGTCCCCCCCCTCATTGGTATATAGGCATATTCAAGTCACTCTTTGGCTAGGTCACTATTGTGGCACACGCAC
GTGATTGGCCTAAAATCAATCAAAGGTGAATATAATCATCTAAGGAAATGCTGGACGCTCATAGGCAAAGGCAGATCGCGTTACCTGAGTATACTGTACT
AGTTTAATACAGACAAAAAAATAAAGGCATCATACTCATTCTTCAGTGTCTGCTGTTGTATAGTGTTTTGCAACTTAGTTCAGTTTTCCGAACTGGATTA
CATATATCAAAGGATGAGCTCCAGAGCGTGCTCCGTATCTTATGTCGTAGACTGCACTTTATTGTTTTCGGCATTACGGAGCAGGGTCATCTACAGACTC
TCTTTGTATTTGTCTATTCAACGCATCCACATTAACGAGTAGCTTGAACACACTACAGTTCATAAGCACATTCTTTATTTGTACACAGGGCACAAATCAT
ACGGTAGTCGTCAACCAACCAAAATGGGTCCGTGAATACGCATTACTTCATTCAGCTCTGGACTGGGTTCCTTGTATGAAAGGCGAGCTCCAGAGCTTTC
TCCTCCATCTTAAATTGTTGAATTTCAACGGATAGGATCATACTCATGCCGTCATTTGTGTTCGGCAACGTCATATAGCGGACTCGCCCCTTCTACGCGA
ACCGTCATTTCATGTCACGATTGTGAAGAATCACTCCTGCCACGCGTATCGTGTATGTCATCGCTTCTCTCGTTCCTTTCGTCGCATCATTTTGTGCGTT
TCTGTACATACGTTCCAGCCTTACTACACTCTGTAGGGATACACATGATAGGCTCGACTTCGCCGTGTACGTGAAATGAAACGGAAAGTGATCCGTAGCA
ACATCGGTTCCCAAACGTTGGGCTCGCCATAATATACTCGAGACAAACTTGATGCCATTACATCAGTCGTAACATGGATGAATGTCATGACGAAATATGT
CCGAATGTGGCAATACCGCGACCTATATCATACTACTGATATCGCTTCTACTAGTGCCTCAAACATTGCGCTTTCTGTAATATTGATGTCAAACTTTCTG
CATTAAGCTGACAATGGGACAGCCTGGACACAGCTTACGTGATGACAGATGGTGAGCTACTAATAATCAGAGCGACTGCACAATGACCCACGTATCGTTT
CAGTGGTTGCAGGTTGTTCCATTTCTCACTATGCCCGGCTCATTGCACCCATATACTGTCTCAACGATGGCCTACCAGTTGACTGATCTGGCTGACCATA
ACCATTAGATCAGAACACCAGTGATCTCAGCAGTACGAGCGAGGATACATGACCAATTGCGACATGATCACGCTATGCATTAGCGGATAGCAGGTAACAC
ACGTGCTTTAGCTTTGTGTTGCGTATTCCTACACTTCAATATGCGACTATCGATGCAGACAGGTGTTTACAATGCGTTGTGCATGTCTCGTTTGGCGACG
AAGGAGGCATGAGCGACTCGAGTAGCGACCAGACGATGCTCAGACGGAGACTACTATACAAGACCGTAGGCTTGACGCGTGGTGCGCAGCCAAACTACAC
AAGCTGTATGGGAAAAGTAGATCACACTATTGGTGACACAATACAGCGAAGAGACATCCTCCCTCCACCAAACATGTTGTGTATCCTCTTTCCAGCTAGG
CAAAGTAGTATATTTCTCACATTTTAGCCACTTGCGACATCCGTGCCACAATGTATGTTTTACGCAAGGAAGTCAATACGTATGGCCTGCGACACCTACG
TGCGTCACTACTCGGTGAGCCAGTTCGTACATATACGAGTATGTGCACCACACCATATTGCGTCGTCCGTGGGCGGCTCCGATCCAGCCGAAACAGTCTG
CGAAAAGCCCACGAAAAAGCCCATTCGGACGCTTTGTTTTGCTATTCAGTCTATAACTCGAAACAACCACCATGAGCCCCGTCAAGGTGTGTGCAATTCG
CTGCTAATAACCTACTTCTCTAAATGGTCACTAACTTGGCTACATTTGTATCCAGACGTGCGTTGTGCTGACTTCTTCCA