Description :
Non Conding Region
Location :
Scaffold_1:31596- 32898
Sequence
1302 bases(100 bases per row)
TTCAACGCAGATTATGGGGGTAGCTCCTGTACGAAGGTCTGCTTGGAGGGCGGTGTAGTGGCGGCCTGGGACAGGTTGCCTTCAGCAGACACTTCGCACG
GTCGTTACCAACGACATGAAGAAGCATGAAAGAGGGGCGAACTCTCTGAGCAATTGTATATTGCATAGAAAGGAGGCATATAGCAAAGCGAAACTAACAG
AAACCACTGCGGCTCGTGCCGCAGCGGCTGCATTGAATACCAGAATTCATTTCACCTCCAAGCAAGGATTCTCAAGCAAGCCAAGGGTCGAAAGACACTA
CAACGAATTATCTTAGCTGGGGACAACGTGTTGGCGTTCTATCGAAGTCTAAACACCCGGTAGCCGAAAAACTATTCATGAACTGGGCCGTTTCAAAGGA
AGCGCAGACTACGGTGCTTTCGACGGCGGTGCGCACCGACACCAACACCACCCACCCTTGGGACATGGAGGACCGCGCGAAGGTGGATCAAATGTTTGCA
CTCTACTTAGGTGAAGCGCAGGGTGAACCGGCCCGGGAGTCAGGGATCCCGAAAAATAGATATCGCGGGAAATATATTTGCATTTTACGTATCAATAATT
TATTTTGGGATTTTTCCTAGTTCGGTCAGTAATTTATGTTTTATAATCTTAATTCTCGGTAACTTATTTCTCCCCTCCATCCAATCGGACAGGCCCATTG
CGGCCACCTACACGCTGCTAGGGGCGGTACCACCAACCTCCAATGGGAGCGTCTCTTTAGCGTGGTTCGTGCCGTTTTACGCCACGAGCGTCATCGCTTG
TCTCCCTTGATGCTGGAGATGATTCTCTTTTTGAAGGTGAACAATTGCCTGTGGGATGTGGCGACTGCCGAGCAGTGCATGTAGGAGATGAACTTGACGA
ACACTATTGCAGTAATTTACTGCTCTAACTCTTGGATTGCAGTTATTTATTTCCTTCCTTTTGTCCTGACAAACAAATACGTATTTCTTTCCTCGTGTTG
CAATAAATATATAGCGAATTTTCGGGATGCCTGCTTGGCACCCACCTCATCACCATACACGATAGTGGTCTCCGGGGGATTGTAACACGTACTGAGCAGT
ACATAGCTTCAGCGTAAAAGCAGCAAGCCCATTTACTTGGGTAAGGCTGCTGTTATACTCGACGGTGAGTATGCATGAATATCGTTGTTGAACGTGGAGT
CGTTCGATAGGTGTGTGTACGCTGCAACGGATAGTCCGCGAAAACGAGATCCCGGTTAGCAAAGACTCAAGAGTTCCATAATCCGCATGCAGTTATCCAT
GT