Description :
Non Conding Region
Location :
Scaffold_1:31386- 33303
Sequence
1917 bases(100 bases per row)
GTCAGGTGCTGCAATCCCCGAGGAGGAACTACGCTAGCTGCAGTACTGTAGTGTTGGGACTCGAGCGAGGCGCGTGCACTCGCACTCCTGACACCAAGCG
TTCCTTTTGCACTGTGGCGGGCCGCCACACTGGCGGCGCGCGCATATCGCAGCCAGCACTCGCGCTGTGCGCGGTTGTGGCTGGACCGTCCACCGTGTGC
AATGCTGCAACGCTGCAATTGCTGTCGGCGAGTTGCCTTTCGCGGCTTGGAGCGGCTTTATGCACTGCATAATATGCAGGCGTCGAGCTGTCAGACATCC
GGTTTCGTGCCGCCGGGGAAGCGCGCAGGGGATTTGACCGCCTAAGAGCAGTGCTCTTAGGCGGTCAAATGCTCTTAGAGCAGGGCGGAAGGGCGCGGGC
TGGCCAAGCCTGGTGATCGACTCTGGCAGCGCTTAGTCGCGCGTGGAGCAAGGCGTCGGCCTTGGTGATGGCAGGGGATTCCGTCCAGAGACCTGGTTTC
TCCATGGCCAATGCACATGTATCATCATGCGTATGAAGGCGCCGGTTGTGGCTGCGGCGGACATGTACAAGTAGCTGACGCCGTCATTTGCACACTTCCG
AGCTCGCCGCACATTATTTCGGGGCGATAACGGCCAGATGACCGTGTTAAATGCCTCGTGGTGAGTGCCCTCGTTTCAAATGGCTGTGCTTACGACGCCC
GGAGATGCTGTTGTGGCCGCTAAGCAGCTCTGGTGCGTGCAAGTTCCTCCGTTGAGACGTCGGCGTTGGCGTCGAGCGAGCACACTTTTTTTCAGGCCTC
CCGTATTGACCGAGCAAGACGGGGCCAAGGCAGACGCGCCTCAACGCTTTCGTTGAACCCGGCTCAGCAGGCACGCGGTTCCCTCCCTGAGGAAGTTCAC
TCATCCGCGGTTTGCCGCGTCGGTGAAGGAGGCAACTGAAAGTGATCGGCCGGTCTGGATTTCGCTCGCAGCGGTCGGCGGCGACATCAGAAGCTGACAA
GCGATGTGCTCGGGGTCGGTCGGAATCCAAACTCCCAGCGCGAGCACGAAATGCGTTCGCAAGCGGAGACCGCCAGGAGGGATCAAAAGTCTCGTGCGTC
GATGCTGGTTGGTGAGGGCCGAGCGGGCGGCGGCACGTCTAAAAATCCGAGGGGTGAACCGCATCTTGCAGTGTGCAAGTATCTTGCTGCAATGCTCGAC
TCTCGCTCGCTGCGACTCCTCTTCATCGTGTTTCTCCTTCTTTTGTGCATTTCAAACTGCTCATCTTTTACACCAATATGTGGAGCTGCTGTGAGGCGGC
CACAAATTCCGGCACAAAACACGGTCCACCCCGGACTGTATCACGGAATGCTTCGTCAAGTGGGACCGAGGACGAACGCCGAGATACATTTATTTGGCTC
GCCACCACAACAAGCATGGGTGGTTCTCTTCTCTATGCGAGCGCTACCAACCCAAAGCCGCGAAAAAATCGAGCAGGGCCATCACCACGAGCACTAACGA
CATTCCCAAAGGATGCTGAGACCTATCGGATATGCATGCACGAGGCTGGGATTCCCTAGCCTGGGGATGATAATGTAGCTGGTGTGCTCGCTCGGAGCCT
CGGTCGCCACCGGTCTACGCCGTAGACTCTACGGAACCCAGTGACAGCCGAGATGATCATTGGGAGCGTGGCCCGATCCCAAGGAAGAGCAGCCAGCCAG
CCAACCTGACCAACCAACCCAGCATTTTGCTAGCTCCGGCGCATAAATGCTCGCACGCCATGCTTTCTTGCTCGCGTGAAAGCCTTTCACGCGAGCAAGC
TCGGCGGGACCTTGAGCCCGAGGCCGCTTGCCCCGCGTGGAGCCACTCATGCGCTCGAAGCTCCGCTCCGGCTACGCTCGCATCACGTCGCGTCTGAAGT
GCACATCGCTTTGCCAA