Description :
Non Conding Region
Location :
Scaffold_1:31286- 35208
Sequence
3922 bases(100 bases per row)
CCCCACACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCTAGCCAGACTATTACTACTTGTACTCTTCGTAATAGGGGTCTTTTGCTT
CTCGTATGATGTTAAGTCGTATCTCCGCCTCAAAACGCCCAGGAATTTCATGATACATCCGTCGTCGTTTCTTGTCTTCCTCAAGAGCTAAACAAGCGAG
TCTCTGTAGCCTCGGATCTCGTTCGCTTCATCTGTTCACGACGTGCAAGTGTACGAGGAGTAACATCTCTATCCGATGATAAAGGGTCACAGTTGTCGGA
GACTGCAGCCTTGGACGCAAGAGTGGCTTTCGTGGGAATTAGCCTTGTTCCTCCTTGCCAGCACAACTAGCTGCTTTACTACACAATAGTTTGGCCGTCG
AGGTAAATTCACGAAGGCTTGGTTCAGGGTCGCGACGGTATAATCGCCCTTCACGCAAAACACAGCGCTTAGGGGTCCCTGCTGTTGCTACTCGAACCGC
CGGTGACATGGCCACAGGGGCAGATGATGCTACTTGAATTGCTCGTGATTTCGCCACACAGGCAGTAGATCCAACTTGTCTTGCCGGCGACTTTGCCGCC
GAGTCGGTATTTTCCCCGCGTGATTGGTTACGTGTGGTATGCTTTGCCGCGAACGTTTCCATGAGTTTATTCTCGCAGAAAAAAACACAAATGGGTTTGA
GCGTAACACATGTCAAAATTATAGCTTCATTTGTGGTGCCCCACCAGTAAATATCAACGTTACAACGTCGTACACCAGCTTACCAGTAAATACTAGTGAA
AGTTACTCGCAGCGGCTCGTATAACACCGAATCTTTTTAAGTATACTAGCCCTTTGAAGATGAAATTTACAAGACGTTGAACGGTTGAATAGTGATTGTC
TGTTAACTGTTGGAAATGGGCCAAACAGAACCGCAGCCGATAGCGTTGAAAACGGCCATATTTTTCTTGTCGTTCAGCTACAATAGAGTAGCCTGTCCAG
CATAGTAGCTTACAGTAGCATATGCATTTTTTAACAGCATTATGCACAATAGGACGTTCAATGGCGTCATGGGTTTTGGACAGCGGCCGTTTTCAACCGA
CCAAACAGCACCGTAGCCGGCAGCGGCTTTCGATAACCGCTCAAAACAGCACTGTAGCCGGCAACGGCGGATGATACCCGCCCAAACAGCACCGTAGCCG
GCGACAACTGATAGTCAGCCATGGCGGTTGACTACCACTCCAGCAGCACTGTAGCTGGCAACGGTTTTTGATAACCGGTCAAACAGCACCGTAGCCGACA
ATGACTGTTGACTACCAATCCAGCAGCACTGTAGCCGGCAACGGCTGATGATACCCGCTCAAACAACAATGTAGCCGCCAACAACTGATGATACCCGCTC
CGGCTACACCGTAGTTAGCAATGGCGGTTGGCTACCGCTCCAGCAGCACCGTAGCCGGCAACAGTTTTTGATAACCGCTCAAACAGCACCGTAGCCACTA
AAACAAAGACGTATTCATTAGCGTTGAAAGAAAGTATTGATTCTTATACAGCAGCCACTGATACAACACAGTAGCTTGTTTAGCACTGCTGTGTATGCTA
GGTTTAAGGAGACCATAATAATAATAATAAAGTCCCAATCATTTTATCATGCAAAGGAAACTACATGTACTGTGACAGTGTGTAGGCTGCAATGATTTCA
AATATGCTCGATCAAATGCAAC