Description :
Non Conding Region
Location :
Scaffold_1:31169- 31785
Sequence
616 bases(100 bases per row)
TCGCGCAGCGAGACGTCTGTCCCCTTCTTCCTTTGCCGCCGCTGTTGCTTCTGCTTCCGCTTCTGCTCTGGACCTTTGTGAAAAATGCGGGGCCTCCTTC
AGCTCCCACATTTCAGCTCCCGCATCAGGAGCGAGAGCGACGGGCTACTATTCGAGACTCGACAAACCACGATTGAGTTTCGGATTTTCTATAACATATT
TTTGAAGGTTTAGAGAGAGAGTTGATGTAACCAAAAACGTTGGGAAACTCGAAATCGGAGGTTTTATGACTGTAACCTCCAATTTAGAGTCCTAGCCTCG
ATTCTTTCACTATAGACTACGTCCTGTAAGCTCCGATCAAAAACCACTGAGCAATATCTTTCGGTTGGCCGCGTCTTACATTCTTCAAGTCAAACGCAAA
TTTTGGCTCATTGAGCGATGTTGATCAAATAGAGCGTAACCCACGTTTCTCCCCAACGTCATTCAGCGAGCCAAAATCTGCGTTTGACTTGGAGGTTTTC
ACCCTCCCCCCATTAAATTAAACATTCCTTCTCCTAAAGACGACAGCACGGTTCTAACTGGACCTCGCACGTCTTTCATTTTCGAAACGAAAGCCCGCGA
ACGCGCGCACACATAA