Description :
Non Conding Region
Location :
Scaffold_1:31164- 31354
Sequence
190 bases(100 bases per row)
GGGCGAAAGTCGTGATTATTAGGCGACAGACGACGAATCTTGTGAGTTTTTTGTTTGTTATTGGTGTTAGTGACAAAATTGGTAGATGGATATGGTGAGT
AGATTTCCTGATCGCTTGTGTGTAGTTGAAGATATACAAGCTATCGTACCAAGGTGCTCTAGCATGGAGATAAGCCATGTCTCTATTGCT