Description :
Non Conding Region
Location :
Scaffold_1:30927- 31141
Sequence
214 bases(100 bases per row)
CCCGAATCGATAGATATTCGTTTTGTATGTGATCTAGTTGAAGTCGTAACACTTGCAAAAACGATACGTAGCCATATCGAAAGATGGAGGTTTCAAGGGA
GTTGTGCAACTCAAGATCTTACCGCAACGTTATTGTTCCGGCTTCCTATTCTTTCTTTGGGAAGAACGAATAGTGAAGCCAAGTGGCGGTAGATTGGGAA
CACCAGCGACACCA