Description :
Non Conding Region
Location :
Scaffold_1:30539- 30823
Sequence
284 bases(100 bases per row)
TCATAAAGAGTCGAATAGGATTTAGTAAATGACCTTTGACCATCAAACGTCTGTCTGGGAAGGTGTCCACGACATAGAATGTGTAATTGCCAGCTGGACC
TTAGGCGAGAGTAAATTGTTTAAAAACACCACTTGATCCACCATATCGATTCGAGCGTTAAACGTACAGCTACACATCCCTCATCAAAACCTTGTGGCGT
GGATCACACTCAAATTGAAGCTCGGAAGCACCTTGATTGCATACAATACTGTGTAAATCTATAATGTACGATGTACTTTCACGA