Description :
Non Conding Region
Location :
Scaffold_1:30362- 30438
Sequence
76 bases(100 bases per row)
CCGGTATCTCTTGAGGACGATTTTGGTGTGCTTGGGCTTCGAATTCCTGAACCTTCTACATCTCCCTGATCTCCTT