Description :
Non Conding Region
Location :
Scaffold_1:30343- 30865
Sequence
522 bases(100 bases per row)
TATGCAAAACAGCGTAGAAACCAGCTTCCTGTGGATCTGTTGCCGCCAGGCTCATCGAGCAAGTGCGAGATAGAGTACTAACTAGTTAAAGCTACATGAC
GTTTCAGCGGAGCATTGGAAGCCTAAAGCGGCGCTGGAATGAATAAAAGTGCTGGACTGCTCTTTCCTCCCAGAACCATTGAGTGTGATGTGGTGCGCTA
GCGTAGACCAAGCGCAAAGACGGCGAGACATAAAGCTGAAAGAAAGAAGGCAAATATGAATATCATAATCATAGGGCGCGTGTAGAGGAAGATAGGAGAG
CACTATCAGCCGTCGCGGAGGCGATTGCAGCGCCAAACTTCAGGTGAACATGAAGACATCACCTCGACTCGCAGTTCTTGTCGGCGCCAGCTTCTCCGTC
GCTGGCACCGCGGTCCTTCCACTGCTACTCCTTGGTCAATCCGTCCCTTTTGTTCGTGGAAGGCGTGTGTGTATAAGATGTATTGATGCGTCTGTGCGCT
GTCCTGTTCTTCTGTTGGCGAC