Description :
Non Conding Region
Location :
contig_1:30183- 33556
Sequence
3373 bases(100 bases per row)
GTGGTGGAGTGGGATCGCAAAAATGGATGACGCGATCCGAGCTTGCCAGCGGTAGGCCCAGACTGCCGACTATCGGAGGGGGTACTCCGTTGATCAGGCG
TGATCAGAAAACCTTGTAGTCACCTTGTGTACCCGACGGCGGGGCGGGTTACGCTCTTCCGGTGTTCTCTTGAAGGACGTCAAGGGTGTGACCAAGGCGG
AACTTGTTGGAGCTGGACTGCTCCTTCCGGGGAATGGGGGGGATGACGGCCACGCGGGTATTCTTCACGCGGTCGTCGGTTGTTGGTGATCGGGTCTTGG
GGTAAGTCGATCACGTGGGGGGTGTCCTTTGGGTGTGCTGTTATAGCCCTTTCCGTTGCTTGCCGCCTCCTCTGGCGGGGTCTTGAGTTGAGATGAGATT
GTACGATTGTAGCGGGGCTACACATTCGGTTCACCTCCTACCTTAGTGCAACATGCACTAAGGCATACATTCAGGTGACCACCACAGGGTGGTCCACATT
CATAGCAAAAGGCATATGACTGGTAGAAAGTAACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTC
TCATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTACCACCAAAGCTTCCGTTTGGTTCATTTATCTAGGTTTAAG
TATACTTGTGGATACAAGTATACTGAACTTAAGTAAACTACTCCTACGCTTCCTCCTACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAG
ACCCATTACAAACGATCGCCCCCTGGCCAAGCTATCCAGATGTGCGACGTGTCCTTGGTTGACTAGGTGAGCCCTTCTTCGGGTAGGCCAATGTAGTTCC
TTCCCCGGGATGTGTGGACGCCACTTGTGTCTTGCAAGGCAAATCAGAATCTATTTAAGCAAAGGTAAAAGTCCTAAAGATCTCTCTCCCTATCCCCATC
CCGCTTGCGTGCCCACCGACTGCACATCACACTTGAACTTCCATCTGTATATCTTGACCTCGTATCGGAATGACAGTAACATTGTACCTAGCATCCATCC
GATCCAACTGTACCACTGTGGCGGTACCATGTCGATCTGATCAGGTGAGTCCAGATGATCGCGTATGCCCAGATGATCGCAGATGTCTGGTTGATCGCAA
GCGTCCGGATGATCGACTGTACCGAAAGGGTGGTACCAGGCAGATAAAATTACCTGTACCATCATTGTGGTACCAAGTCAGGTGCTGGGCTATCCGGACA
TATCCGGCACCAACCCCAACCCTTCTGGTCCAATCAGTCCAGACGCGATCTCTTCCCATCATCGGCAATTTGACCCAGGTCGCTTCACCTCACTTCCTCA
AGCGCAAGGTGCTGTGTGACTCCCGTCACACTTGGTAGCACTTGTAGTCAATCCTCGCCTACGCGGGTAGGATTGGACTACCTGAATCCTCTGTGGTCTC
AAGCATTGAGCCACCATGGATCGCAGTGAGTTTCCTCACTTGAACGACTCGCAGTTCGAGTCCGTTCGGAAGATGGCGGGCATCGTCGGGATGGATACCC
TCCAGAGCTTGGCGGCAGCAACACCTGCCGAACGGCTCGAGCGCGTAAGCGCTTTCGACACGTACGAGCAAGGGCTAATCGCCCATGTACGTGGGAGCCT
ACAGGCCCCTGTGGCTGAACGGAAACCAGTTCAGCCTAAGCCTTTGAGGCTGAAGGTTAACCTCTACGAAGGAAAAGAAGGGGGAAATCTTCACTTCTGG
GTCCGAGAGATCGAGCTCGCTGTGGACACGGCTCTCGTCTCGGACGAGCGACTCCGCGTCGCTTTTGCTCTCTCCCACCTAAGTGGTCGAGCAAAGTGCT
GGGCGTATACGCGCGAAGCGACAACGCCTGGATGCTTTGCATCCTGGGCTCAGCTGTGTGAGCAGCTTCGAGCCGCCTTCCTCCCGGCGAACTATGAGTA
CCGCCAGCGCTCACACTTCCTTGCGTGCAAGCAAGGGAGACGTGAGCTGTATGAGTACATCCAGAAGATGCGGGAGCTTACCGCATCTCTGGTGGGAAAC
CCATTCCATAAACACGGTGTTCATGGACGGCCTACGAGTAGGCCCAGCGCGCACGCAGCTGTTTCGGGTGCAAGCAAGCACCCTGGAAGAAGCGATTCAA
ATTGCTCTTCAGGAGGAGTACAGCCATCGACAGGCTCGCACTCCTGCCACTGCGTGGCTTGGGGGCTCCACTCAGGGCGGGCCCCAAAGTAGGGGCCCCT
TCAACGGTCCTGTGCCGATGGACCTGAGCCTTGCCGAACAGCACGACATGCGCTGTTTCGGCTGTGGCAAACTGGAGCACATGAAACGTGCGTGTTCCGC
GGGAGGAACAACCCGGCGATTTCCTTCCAAGCCCTTCGGTCCTAGGGGTCGCTGGCAAAAGCCACGACCCCGTGGCCAGGGGAACGCAGGGAACCAGTAG
GGGCGGGGAGCCCTACTGGGGAAGATCTAAGTCTTCATGAGTGGTGCGCGGGTGGTGCGCACCATGAGGGCTTAGCCCCTGAGAGTCTCTGTACTCTCGA
AGCGGAGAAGGGCAGAGGAGGGCTGCTTGTAGTACATGCAAATGTACGGGGATACGATCATCCCATGAGAATCTTGATCGATTCTGGGGCGTCAAAGAAC
TTTGCACGCCGCCGGACGGTCGCTCGCAAGAGCGACCAGTTCACCGATGCTTTACGAGAAAGCAAAGGGAACGGGCATGTCCTAGTCAGACTGGCTGACG
GGACTGTAGTGGAGGTGCCCAAGGTCTTTATGGACCTGTCCGTCAAGTTTGAGGACTTAATTCCACTGAACGATTCCTCGTTCTTGATATGGACAAGTAC
GACTTGATCCTGGGCATGCCATGGCTTGAGAAGCATGAGCCCTGGATAGACTGGCGCGGCAAAGCCATCGGGGCTAGCCGGCCTGTTGCTACTGACAGAG
CATTGGTGAGTCATGTTCCCACCTCTGTCAGCAGCCGGGCCTACCACCGGAGCCGAGTCAGAAACGACTCCGAAGAATTAGTTGCGGCAGGAGCCGCAAC
AGGTGTCATGACACCGTCCACGGCGGGCAATGGGCCGCCACAGGCAATGCCGGTGGACAGGACTTCGAGTCCAGCGAGGGGAACTGCAATGCCAGCAGTA
CCCACCGCTCCTGACTATGGCACCGTACGGCCTTCGGCCTTGTCGACGCCGGGGGAAGTCAACTCCCCAAGGGAAACGAGCCCACGTGAGACCAAGGAGG
TCGAGACCGTGGCCAGGGTCGAGGTTGCTGGGAGCACCTCTAGTGTGGGTAACAATGTGCCACACGGAGTCGA