Description :
Non Conding Region
Location :
contig_1:30171- 31689
Sequence
1518 bases(100 bases per row)
GTGGTGGAGTGGGATCGCAAAAATGGATGACGCGATCCGAGCTTGCCAGCGGTAGGCCCAGACTGCCGACTATCGGAGGGGGTACTCCGTTGATCAGGCG
TGATCAGAAAACCTTGTAGTCACCTTGTGTACCCGACGGCGGGGCGGGTTACGCTCTTCCGGTGTTCTCTTGAAGGACGTCAAGGGTGTGACCAAGGCGG
AACTTGTTGGAGCTGGACTGCTCCTTCCGGGGAATGGGGGGATGACGGCCACGCGGGTATTCTTCACGCGGTCGTCGGTTGTTGGTGATCGGGTCTTGGG
GTAAGTCGATCACGTGGGGGGTGTCCTTTGGGTGTGCTGTTATAGCCCTTTCCGTTGCTTGCCGCCTCCTCTGGCGGGGTCTTGAGTTGAGATGAGATTG
TACGATTGTAGCGGGGCTACACATTCGGTTCACCTCCTACCTTAGTGCAACATGCACTAAGGCATACATTCAGGTGACCACCACAGGGTGGTCCACATTC
ATAGCAAAAGGCATATGACTGGTAGAAAGTAACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCT
CATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTACCACCAAAGCTTCCGTTTGGTTCATTTATCTAGGTTTAAGT
ATACTTGTGGATACAAGTATACTGAACTTAAGTAAACTACTCCTACGCTTCCTCCTACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGA
CCCATTACAAACGATCGCCCCCTGGCCAAGCTATCCAGATGTGCGACGTGTCCTTGGTTGACTAGGTGAGCCCTTCTTCGGGTAGGCCAATGTAGTTCCT
TCCCCGGGATGTGTGGACGCCACTTGTGTCTTGCAAGGCAAATCAGAATCTATTTAAGCAAAGGTAAAAGTCCTAAAGATCTCTCTCCCTATCCCCATCC
CGCTTGCGTGCCCACCGACTGCACATCACACTTGAACTTCCATCTGTATATCTTGACCTCGTATCGGAATGACAGTAACATTGTACCTAGCATCCATCCG
ATCCAACTGTACCACTGTGGCGGTACCATGTCGATCTGATCAGGTGAGTCCAGATGATCGCGTATGCCCAGATGATCGCAGATGTCTGGTTGATCGCAAG
CGTCCGGATGATCGACTGTACCGAAAGGGTGGTACCAGGGCAGATAAAATTACCTGTACCATCATTGTGGTACCAAGTCAGGTGCTGGGCTATCCGGACA
TATCCGGCACCAACCCCAACCCTTCTGGTCCAATCAGTCCAGACGCGATCTCTTCCCATCATCGGCAATTTGACCCAGGTCGCTTCACCTCACTTCCTCA
AGCGCAAGGTGCTGTGTGACTCCCGTCACACTTGGTAGCACTTGTAGTCAATCCTCGCCTACGCGGGTAGGATTTTGGACTACCTGAATCCTCTGTGGTC
TCAAGCATTGAGCCACCA