Description :
Non Conding Region
Location :
Scaffold_1:30027- 30179
Sequence
152 bases(100 bases per row)
GGTATTACTTGCTATTACGGAGAGCATTACAGCTATCCTGCTGGTCTCTGTGCGCCTCCAATATATGGGTCACTGCGTCATCGGGGTTTGACATCTCTGC
GTCATGTCGTTGACTATGAATCTTCCGCACCGCGAGCGCTGCGAGTCTTTAT