Description :
Non Conding Region
Location :
Scaffold_1:29804- 30732
Sequence
928 bases(100 bases per row)
AAGTGACAGTTACCTACGCTGTCGAAACCGCCGCCGGTTACGATTCTCGTAAGCCTTAAATGGCGTACTGTACGCGTACATATATATGGGCATGCAAGAA
GTGACGCCCAAGTGCATTGCACCAACTGCAGGAACACGAGCCATCCAGCGATCGGGTGGAGGGCGTTGGACACCGTGTCCAACGATCGAGTGTCTATCCA
TTTCAAGCGAAAGCTACGCTTCCGATGAGATCGACATGCGGGGCTGGAGCTACAGGACGACCATGTTACCGGATACGGCGGTTCTGGTGACGTAGTCTTC
CAGTTGAGGGAGTAAAGACATAACGTTCCTTTAATTCAACTGTACCGCTCATGTTGATCGCGCCTCTCTACTACCTCTAGATGACACAGCCGTGGTCATG
CTGCAATCGAGACCACCAGAGACAGCGGGTTTTCGTATGACGCCCCGCGCGGGCATTCAATGTCTTCCCCTTGCAGCGGCCGTCGACGAGGGAGATGTGT
TTCTTCCGTACTAGTACGCGTCGTCGGTTGCAAAACGTTACTATTAATAGGTCGGCAATCTCGCGAAATGTCGCAAGTTGAAGTTATAACCTGTTGCCCT
TCTGCTCCGCTGCTGCTTCGTTTGCTGTTGTGTCCTCATCTTCCAGCGTTTGTCGCGAGACTCCCATCTTCTGCGACTTCATAAGAGACGGGTCAGTCCA
AGCATGGTTGACCTCCATTCTTATGGGCTGACAGCCTACTACTATAGCAACATGCATGTTCTGTGAAATTCGCTAGTTTTTGATTGGGCAATAATACTCA
AATGCCTAGTTTGGATTGGTGATAATTATAAAATGGCGACGACGGATTGGTCACTTTCTGAGGGCCAACCATTCGCCCTTGAGAACGAAGCGACCGAAGA
CACTTCCCATTCAAGAATCCAATCAAGA