Description :
Non Conding Region
Location :
Scaffold_1:2965- 4217
Sequence
1252 bases(100 bases per row)
GTGCGGGGGATGGTTTTGGTGTGGCTGGGAGAaGAAAAGTTGCCGAATGAACTCCAGTCACTGCCCAAAAACTCTCTGGGAGACGCCTGGATAGACTTCG
ATGGCTCTGAGTGTCATCGTAGCCTCCAAGGGCGAACGCGATCCGCCATTTCATCCTTGAATGTCGACGACTCCACACTCTGATCTCCGTCAGCCGTCAA
ACGGGTTGTTGAGCCGTCATCGCAAGTGCCTGTTCCAATGCCGCAGCTGGCAGGACAACTCATTGATCCACGGGCtGTTTGTGGGCCTGgTCGGCGCGCT
CCACACACACTTGGTTGACATGCCACACTCGATTATGGATTGCGTCGCAGCGATAGTGGTCTGTCATCACGATGTGGCGGTCGCATGAGATGGCTGTCCC
GGTCTCTGCACACGGGGCGGCACTGTGCAATGAACGACGAGACGACCTGCGGCGAGCAACTCATTTGACTGCCCTCCcGGGACTTGCATCACGTGGCCCG
ACGGAAGATGCTGGTGAGTTCCTGCTGTCGGGAAGCATGCAGGTGGATGCACCGACTGATAGAACTAGTCATCTGGGGGCGGACATGAAGTGACATCTGC
TCGTGCCGTTGATGTCATGACAACAACTACGCCAGGTTGCCACAGTTAGCGCTCATGCTTCTAGTCGTAGTATGTCCATCGGTACGGTACCTGAGCCTTT
TCGGGGCAATCTGCTGTGCTCTCTGCATCGGCAGACGACACACGAGTAATGATGGAGTCCATCATGGACAGCAGAGGCACACTCTACAACACAGTGCTCT
CGTGTGTACTGGCAGTCGAGAGCGCGTGAAGTTGGCATATCAAAACACAGCGGGAACAGCGAGCTTCCTTGGTAGCCATTGGACGCCAACTGGGTTTTCT
CGTGCAGCACGtGgCAAACTGATCGCCTCTTTTGAGGAATTGAGAACTTCAGTGCCGTCACCTAGAACTAAAGTAACTGCGCATTCACCCAAAATCTGAT
TGAGGTGAGGCGCATTGTACCAGTTCGAATTCTGTACAGCACACCGTCGTCTTCGCCACTTCGTATTTGTGTCtGTTTcTCCCTTGATCATCAGGGAAGG
CATTGGGTGGGATCACGAAGACTTCGATCCCCTGCTTTGTTCGCTCTCGTTATGTTATCCATATCTTACTTTACAtCCGTTTCGCGTAATGCACAAACCT
ACAAGTACTAATACAACCCTTTCAAATACTGTGGTGGATCTGCAGAACCCTC