Description :
Non Conding Region
Location :
Scaffold_1:29275- 29433
Sequence
158 bases(100 bases per row)
ATTTGTGCGTTGGGTGCGGTATTCAGCGTAATGCTACTAAAACTCTGCTCTGATGATCGTGGCATGAGTAATGGCGTCGATATTTCGACGGCCCCGTGGC
ACTGGAAAACTTTCTGCTCAAACACGCAAGACATCTTGTTTAGACTCGCAACAAACAC