Description :
Non Conding Region
Location :
Scaffold_1:29221- 29394
Sequence
173 bases(100 bases per row)
ATATGATCTCTTTCAGATATGATAATATTGTAAAACGTACATCTAGGGTGGACCACATAACTTATTATTTTGACGCAATTTTGTATGCCAATACAAATTT
GAATATAATAAAATTAAATTGTGCGGCTTGGATCAATGCTTTGCCACTCAGTAAGTTACGTCAGATTGGAAGA