Description :
Non Conding Region
Location :
Scaffold_1:28855- 29493
Sequence
638 bases(100 bases per row)
GCTGTCGCTGCGAGAGTATTCCTCGACAGGAAATTCATGTCAGCCTGGCAGTTCTGAGCAACTTTCTGAGCAACGATTCAAGATCGAGCCTTGTGTTCGG
CATGATGGCACGGATGGGATAGTCATAGCGCGCGATGAGCCATCGCCCATCGCGCGCTATGAACGACCGCGAGGAATTTTTTAAGCTTTGTGCAAAGGTT
GCTGGATGGAAGTGACCAAAGTTTGCTGGAATGATCGGTGTTTGCTGGAGCTGAAAATGTCCTTGAAGTGCTTCGGTGTCGGACCGAAGCTTTGGTGAAG
TCCTTTTTCGTCCCCTCCTGCCATCGTGCCGTCCTGGCGATGCCAAGCTCGATCGAAGAGGAATTGAAAGCGCCTGGGCGGAACTCACGATCGCAAGAGC
GATCGAGTTGAAGCTTTGCACCGGAGGTGGCTTCACGTTCGAGTTTGTTTGTGCTGTAAAATTTCAAGAGGAGCAACCGGTAAAGCCACCGAAACATTGG
TTCAGGAACATGGCATTACACTCGAGAAAATCCTAACTACGTGATGTGGTTGATGTACGTGACTACCGTACGCGGGTACAGGTTCATGAGCAGTAGTCAT
CGTTGGTTGTTTAGCTTGCTTAGCTTCATCGCTTGAAT