Description :
Non Conding Region
Location :
Scaffold_1:28816- 34251
Sequence
5435 bases(100 bases per row)
ATAAACAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNTCTAGCACCTGCAGCGGCGCCACACTAATTTCACATTTCTGGTGTGCCAGTTCAGCATTCCTCCTCAAAATAGGCGGTTGACACTCCAAAAA
CTAGTGCACTTGATCTACTACGCGTGATAGATCCCTTCGAAACGCGTGTATACTGTCGAGTGAAGCAATGAATACGCACGCTCCAGGTGCCCAAATGTTC
CAGTTAGCCATGACCTGTTAGAAGCGACAACTGTTGCCATCGCGGGGCCTGTCTCGCGACCACTCCTTTCTCGGTGCAGAGGAGACTCGCAGATGCCCCG
TTCCGTCCTTCTTCGGGCACAAAGACTTGGATATTTCATTTCCAGCTTGATACAGATAGCATTTCGCACCCCAGTGCATTTTCCAAGACGAATTGGCTGC
ACCCAAAAGTACGACGCTTTTACCTACTGACAGCAGCTGCTGACAGCGACCGCAGCTACTAACTGCGGCCACATAGGATGCGATGCGCCGATTAACCCTG
GGATTGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNGGAGTTTTTTTCAAGAGTTACGACTTTCGAGCATATTTCTCCAAAAGTTACGACCTGAGGCAAAATATTCAAAATAGTTACGACCTCGACCGGAT
TGGTAGAAATGCAGTCGAAAGCCAACGAATCAAGATGGTGGTCACGCAAATAGTGTTAAAAGTATCTCTCCGTTGCTTTCCGTTGCCAAGTTGAACAAAA
TTAGAACAACTCATTGCACTTTGGGTCGTGTCATTGAAGAACCTTCTCCATGGCAGCTCCTCTCGAAACAGCCCCATGCATCGGCCGCACCTTCTCATCG
CGCACCGATTATTCAGCATACCTCGAGAGGTGGTCGTTCCAGAACGGCTTTAGCGTGTTGCAGGGTATGGTCCGCAACGAGTACTGTCCATATAACTTAT
CCATGGCTAGCGACTTCGAAGCGGGGCCAAGTTACGACGATACAATCCGGCAGAGAACTCAGAAGCTCTGGCAACAGTGTGATCTTCACGTGCAACCCGC
CAAGCCTATGCAATTGGACGATCCGGGCAACCAGGCCGAAGAATAACCCGGTGCACACAATCACAGGTTCAATCTTTTTGATGTACAACGTATGAAATCG
CATCCAATAGAGATGAATCTCGAGCACTCCGATACGTGTGCGTCCACGCCCAACGCATCCGTCCGCCAAATCACGCAAATCCCAGCAGTAGCGGAGATCG
TTCGGTCGACCCCCAATGTATCCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGCAAAGCC
CAAACCAGCGCATCTTGCTCGACGACGTGTCGTTGGGTTGTTGCCGCCACCAGATGTATAAACACCCTTTGAGCACTCTCGCAACCAGAATAGCTAGTAT
CATCTTTACGAATCAGGACAAGCAAAGACACTCATGTCAAAGCTGATGCGCTTGTTGGGTTGGTCATTCTGCATCCCTTGATGAGCTCTCTGCCAGCACC
ACCACGTGCCTACGGGTCATCACTCTGTAAAAGACCATCACTCTCAAATTGCTGGAGGCAGCAAGTGCAAACTACGACCACTCGACACGAATACATGTAC
GAGCGGCCAGCAACTTTCATGTGCAGTCCGATCAAACGCTCCATGGGATGTAGACTGCATGATCATCCACGGCCGTCAAACCGTTGTCGTCCAAGCTCGA
TAAGTTGGCCAATCCTTGCTAGGCGCTCCTCGTCGCTACAAAACATCCTTCACGGAGTCGAATCCATTGCCTTGGTCTCGTGCCCTCCGATGCGAATGCG
TGTACTCGATGAACCGATCGATGGCGATCTCCAAGCTGGATGCTACACGCTCCACGACCTCTACCGAACCACTGCACCTTCCATCGGACGCTCCTCGCCA
GTCGAAAGCAGAGTGACCAAGTTCAAGCGGGTGCACCCGAGACGCGACACGTGGTGCGAGCCGGATAAGTCCATAGATCTTGTTTGTCGCAGTTTGGGCA
ATCAGCGCTGTTGGATGGCGTCCGTGGAAGATCCCTTTGGCGGTTATCGATGGGTCCTTCCTCGCCCTTCCAGCCGCCCGCTGTGCGCCGGCCCAAGGGT
CGGTTGCCTGCGCTCCATCGCCCGCCATCGCCTCCCGCCGTACGAATCGCTGTAGCTGGCGCCGTCGCTCCAGGATCGTCGTCGGCGGTCTCGCGTCGGC
GCAGCCAGAATAAAATTCTGATGTCCCACGGCCGCCGGCTGGCTGATTCTTTTGTAAATAAAATGGTTTCATACAATCACGTAGATAAAATAAATATTGC
CCTGTATATGGTCCGGCGTAAGATCCCTCATTTTC