Description :
Non Conding Region
Location :
scaffold_1:28780- 31675
Sequence
2895 bases(100 bases per row)
GTGTAGTTCGCTAATTGTCGAAAGTAGTCATTTATCTGTTGTGAAATGGAGACATACGTTGTTGATGCACTCAGAGCGTGTTTTTGCTTCGTAAAATATG
TCGTGCGACAAAATTTCGAGCTTCGTATCGCAATTCTATTTCAGCAGTCGTCGCAATAAGTATCAAACGATTTTGTTGAGTATAACGATTTATGACAAAC
CAAGAAACTGTTGGCATCAAAATGGTGCATTAGTGCACGCACCGATTTTATGCTTCTGTGCAGGAGTACGTTACTTGATTGAAACAGGTTGGTTTTCTCA
AGGGTAATTCATAAATGAGCTTCCCAAACACATTCTTCACCAAATGGTTCTCATATGGGACCCAATTCAGTATTAATACGGATTATATTCGCCTGGCTCA
CACTAGACGATACCTTCGACATGAGCACTCTATCTCGTACTTGATTTCACAATGAATTATGGGCGTTATGAAAACCCTTTATTCCCCAATCGAGTGTGAG
CGGTCTTTTGTGTATTCACGTTACGCTCGTCGACTCGTCTACGACTACACCGATCTCGTCCCATGCATGTCTATCTCAGTATCGAAACTCGGCGAAGAAG
GCGTAATTGACTCCATCAACGACAACGAATTTGGACCAGAATCCAAGGATTGATTTCTTGGTCATCACGACTGTGTAAAATGGACTATTTGAAGAGCGCT
TTCACCAGGAATTCACGTACGATTTACCCATCGACAAATGGTGGCGATCGAAATGTTTATGCCTTGATGTACGCTATTCGGTCACTCTTGATAAAATGTC
CTTGGAATACCGATATCGCCAGCCTGTACGTAAAGCGTGAGACCACCAGGACCACGCACGTGGCGATGTCACGCGTTTGATACTTTGCTTTCAACCTTTG
CTAGTGTTAGCTCGCGATGCATTTATATTTACTTACGGCTGGCAGAGTTGCCTCAAGAAACCTGCACATCAATCTAGCGCTTCAGAAGCGCACTGTTGAT
CAATATACGACACCATCGCGCCGTCCACCTTCTCAAACTTAGCCTTGTTGCTGCTCTTTTATATCAAAGTTGGCAAAAGTTTGCCTCCAGTTGTTGTCAG
ACCATTGTGCGCACCGACAGAAACGTAGTTGAGTGAGCCACAACGTGCCGAACGCCAATCAGGACCTGAGCATCCTGGAATTATACCCTCAGTGATGGAC
GCAAGAAATGAATTCGATGTCGCATTGTCGTCGGAGATAGAGATGTAGATTCAAACTCAGGGTCTGAGCATCCTAGAGCTATGCGCACGCAAGAACTGAA
TTTTGTGCCACATTGTCGTCAGAAATAGAGATGAAGATTGCAAACCTCATGTTGGCGATCCACgttcaaaatattttgtcttTTCACACTACATTTTAAT
GAATTCGTCGAGCAACAAATCGTCCATCTGCGAATTGGCCACTTTCTGAAAGGATTTCATCAGCAAGGAGTCCAATCAATCAAAATGGGCTAACGCACGA
CGTGATAAATAATTGCATTCTGTCTGTGAAAAAATTGGATACACAAGTAGAAACCTAAAAAAGTGCAATGCAGTTGAAATTCATGGATGTATTTGTGCTG
CCAAGACCCAATTGTGAGCAACCACATTAGCTAGGAGCTAATCGTTATTCGACGCTGAGGAGCAGACGAAAAATCGCTATATCATCATCCATCAAATCTT
ACTTAAAATACGGTTATAGTCTGTCTGTCTACACAATACCATAGCAGAGGCCGCCTGCTCAAGTGTTCGTCCGAGGACAAAACTAGTGGGGACTGGTAGT
AATCCACATTGAAGTTGGCACAGGTTACAAAGAAAGCATTCTTTATTTAAATACGAACTGTCTGAAGTAGAGTATACAGCAATCTTCTCGCAGCACTAGA
ACTTCCTGCAGGCGCTAAACCGCATTTAACTTGATATCACAGCTGCTGATGACGTGACGAgcgttttgatgcaataatcatcgCCGCTGCGTCAATTTGA
TGCGTCTGATCTAATtggatttgctgtagcacgtctggaagcggtaAAACGCAATTAACTTCAtttttcagctgctgataacGCGACGGGACCCAGGGGA
CAATAATGGAGAAGGATATCATGAATGCCATCTCGGAGAGAGAGATTATTGATTATGATTGATCGCATGATGGGGAAGAGGAAGAGATAGAGGCAAGGAA
GAAGGAGGTCAAAGTAGTTAAGGAACCTGAAACAGAGCGGAAGCGAATTCAGACACCTCAGAACCACTACGATTTGATGGAGACATAGCAGATTTATTAT
CATTTACAGAAATGGACGAATATTTAAGCGTGGAAATCAAAAGATTGACCTCGGAACAAGCCAAAATGGTGGAGAGTGCAGTGACAAGACATGTTTGCTG
AAGTGATTTCAACACGGCCTGTGGAACCGCTATACCGGAACGAAGCCACAACCTGAGTTGAGGATCGGTAAATGCTGCAACTTTTCCAGATTGAAGTTTC
GAAAGATGTTTTTTCTTGCAACAATGATCTTTATTTAGTCTTGTGATCTCACAACGAACTTTTGCTCGACGAGGCCGTTTCTGAGTATTTGGGCGCGGGT
CAATAGCGCATAGTCGTGCACCTAGCACAAAGGAATCTTTGATGAATCCGCTTCTACAAAAGCATAGAGGTCTTTACCGTTACTACGTGTCCAATTTGTA
GAAATTGAGGATCTATGCAACCTACGTCGTTTTATACACTTTCTGTTTGCTGATGCGCAGCTACTGCCACAAACCCGTATGGCCAAAAcgcgcatctttg
gcgcttGCACCTAACAATTCGATAAAGCATAAATGTATGTCGAGGGCACAATAATCGTGTTTCAAAAATAAGAATCTTGGAATACAGCTCGATCT